Journal of the Faculty of Veterinary Medicine, Kafkas University (Yılda altı sayı yayımlanır) (Published Bi-monthly) htp://vetdergi.kafkas.edu.tr Online Submission: htp://vetdergikafkas.org 22 2 MART - NİSANMARCH - APRIL 2016 ISSN: 1300-6045 e-ISSN: 1309-2251 KAFKAS ÜNİVERSİTESİ VETERİNER FAKÜLTESİ DERGİSİ JOURNAL OF THE FACULTY OF VETERINARY MEDICINE, KAFKAS UNIVERSITY (MART - NİSAN) (MARCH - APRIL) Cilt/Volume: 22 Sayı/Number: 2 Yıl/Year: 2016 This journal is indexed and abstracted by Thomson Reuters Services beginning with Volume 13 (1) 2007 in the followings: • Science Citation Index Expanded (also known as SciSearch®) • Journal Citation Reports/Science Edition This journal is also indexed and abstracted in: • THOMSON REUTERS - ZOOLOGICAL RECORD • ELSEVIER - SCOPUS • CAB Abstracts • TÜRKİYE ATIF DİZİNİ • TÜBİTAK - ULAKBİM Yaşam Bilimleri Veri Tabanı • EBSCO YAZIŞMA ADRESİ (Address for Correspondence) Kafkas Üniversitesi Veteriner Fakültesi Dergisi Editörlüğü 36040 - Kars / TÜRKİYE Phone: +90 474 2426807-2426836/5228 Fax: +90 474 2426853 E-mail: vetdergi@kafkas.edu.tr E-ISSN: 1309-2251 ELEKTRONİK BASKI (Electronic Edition) http://vetdergi.kafkas.edu.tr ONLINE MAKALE GÖNDERME (Online Submission) http://vetdergikafkas.org Bu dergi Kafkas Üniversitesi Veteriner Fakültesi tarafından iki ayda bir yayımlanır This journal is published bi-monthly, by the Faculty of Veterinary Medicine, University of Kafkas Kafkas Üniversitesi Veteriner Fakültesi Adına Sahibi (Owner) Prof.Dr. Gürsoy AKSOY Dekan (Dean) EDİTÖR (Editor-in-Chief) Prof.Dr. İsa ÖZAYDIN EDİTÖR YARDIMCILARI (Associate Editors) Prof.Dr. Mehmet ÇİTİL Prof.Dr. Özgür AKSOY Doç.Dr. Duygu KAYA Yrd.Doç.Dr. Erol AYDIN Yrd.Doç.Dr. Ali YİĞİT YABANCI DİL EDİTÖRLERİ İSTATİSTİK EDİTÖRÜ (English Editors) (Statistics Editor) Prof.Dr. Ömer UÇAR Prof.Dr. Gül ERGÜN Prof.Dr. Hasan ÖZEN Prof.Dr. Muammer TİLKİ SAYFA TASARIMI WEB TASARIMI SEKRETER (Design) (WEB Design) (Secretary) Dr. Erol AYDIN Dr. Ali YİĞİT Fahri ALTUN BASKI (Print) ESER OFSET MATBAACILIK Tel: +90 442 2334667 ERZURUM DANIŞMA KURULU (Advisory Board) Prof.Dr. Kemal AK İstanbul Üniversitesi Veteriner Fakültesi Prof.Dr. Harun AKSU İstanbul Üniversitesi Veteriner Fakültesi Prof.Dr. Mustafa ALİŞARLI Ondokuz Mayıs Üniversitesi Veteriner Fakültesi Prof.Dr. Feray ALKAN Ankara Üniversitesi Veteriner Fakültesi Prof.Dr. Çiğdem ALTINSAAT Ankara Üniversitesi Veteriner Fakültesi Prof.Dr. Kemal ALTUNATMAZ İstanbul Üniversitesi Veteriner Fakültesi Prof.Dr. Mustafa ARICAN Selçuk Üniversitesi Veteriner Fakültesi Prof.Dr. Mustafa ATASEVER Atatürk Üniversitesi Veteriner Fakültesi Prof.Dr. Sırrı AVKİ Mehmet Akif Ersoy Üniversitesi Veteriner Fakültesi Prof.Dr. Les BAILLIE Cardiff School of Pharmacy & Pharmaceutical Sciences Prof.Dr. Metin BAYRAKTAR Fırat Üniversitesi Veteriner Fakültesi Prof.Dr. Burhan ÇETİNKAYA Fırat Üniversitesi Veteriner Fakültesi Prof.Dr. Recep ÇIBIK Uludağ Üniversitesi Veteriner Fakültesi Prof.Dr. İbrahim DEMİRKAN Afyon Kocatepe Üniversitesi Veteriner Fakültesi Prof.Dr. Hasan Hüseyin DÖNMEZ Selçuk Üniversitesi Veteriner Fakültesi Prof.Dr. Nazir DUMANLI Fırat Üniversitesi Veteriner Fakültesi Prof.Dr. Emrullah EKEN Selçuk Üniversitesi Veteriner Fakültesi Prof.Dr. Hüdaverdi ERER Selçuk Üniversitesi Veteriner Fakültesi Prof.Dr. Ayhan FİLAZİ Ankara Üniversitesi Veteriner Fakültesi Prof.Dr. Aytekin GÜNLÜ Selçuk Üniversitesi Veteriner Fakültesi Prof.Dr. Ekrem GÜREL Abant İzzet Baysal Üniversitesi Fen Edebiyat Fakültesi Prof.Dr. Tolga GÜVENÇ Ondokuz Mayıs Üniversitesi Veteriner Fakültesi Prof.Dr. Armağan HAYIRLI Atatürk Üniversitesi Veteriner Fakültesi Prof.Dr. Ali İŞMEN Çanakkale Onsekiz Mart Üniversitesi Su Ürünleri Fakültesi Prof.Dr. Zafer KARAER Ankara Üniversitesi Veteriner Fakültesi Prof. Dr. Marycz KRZYSZTOF Department of Regenerative and Stem Cells, European Institute of Technology Prof.Dr. Arif KURTDEDE Ankara Üniversitesi Veteriner Fakültesi Prof.Dr. Erdoğan KÜÇÜKÖNER Süleyman Demirel Üniversitesi Mühendislik Fakültesi Prof.Dr. Mehmet MADEN Selçuk Üniversitesi Veteriner Fakültesi Prof.Dr. Vedat ONAR İstanbul Üniversitesi Veteriner Fakültesi Prof.Dr. Metin PETEK Uludağ Üniversitesi Veteriner Fakültesi Prof.Dr. Sevim ROLLAS Marmara Üniversitesi Eczacılık Fakültesi Prof.Dr. Berrin SALMANOĞLU Ankara Üniversitesi Veteriner Fakültesi Prof.Dr. Sabine SCHÄFER-SOMI University of Veterinary Medicine Vienna Prof.Dr. Ayşe TOPAL Uludağ Üniversitesi Veteriner Fakültesi Prof.Dr. Cevdet UĞUZ Afyon Kocatepe Üniversitesi Veteriner Fakültesi Prof.Dr. Zafer ULUTAŞ Niğde Üniversitesi Tarım Bilimleri ve Teknolojileri Fakültesi Prof.Dr. Rıfat VURAL Ankara Üniversitesi Veteriner Fakültesi Prof.Dr. Halis YERLİKAYA Fırat Üniversitesi Veteriner Fakültesi Bu Sayının Hakem Listesi (alfabetik sıra) The Referees List of This Issue (in alphabetical order) ADANIR Ramazan Mehmet Akif Ersoy Üniversitesi Veteriner Fakültesi AĞAOĞLU A. Reha Mehmet Akif Ersoy Üniversitesi Veteriner Fakültesi ALBASAN Hasan Ankara Üniversitesi Veteriner Fakültesi ALTAY Kürşat Cumhuriyet Üniversitesi Veteriner Fakültesi ALTUN Soner Uludağ Üniversitesi Veteriner Fakültesi ARSLAN Cavit Kafkas Üniversitesi Veteriner Fakültesi ARSLAN Mükremin Özkan Kafkas Üniversitesi Tıp Fakültesi ASLAN Loğman Yüzüncü Yıl Üniversitesi Veteriner Fakültesi AYAŞAN Tugay Doğu Akdeniz Tarımsal Araştırma Enstitüsü AYAZ Naim Deniz Kırıkkale Üniversitesi Veteriner Fakültesi AYDIN Cenk Uludağ Üniversitesi Veteriner Fakültesi AYDIN Levent Uludağ Üniversitesi Veteriner Fakültesi AYTEKİN İsmail Balıkesir Üniversitesi Veteriner Fakültesi BAĞCIGİL Arzu Funda İstanbul Üniversitesi Veteriner Fakültesi BAHAR SUNAY Fatma Balıkesir Üniversitesi Veteriner Fakültesi BAKİ ACAR Duygu Afyon Kocatepe Üniversitesi Veteriner Fakültesi BİRDANE Yavuz Osman Afyon Kocatepe Üniversitesi Veteriner Fakültesi COŞKUN Ş. Ziya Uludağ Üniversitesi Veteriner Fakültesi ÇELEBİ Fikret Atatürk Üniversitesi Veteriner Fakültesi ÇELİK Ufuk Ege Üniversitesi Su Ürünleri Fakültesi ÇEVİK Mesut Ondokuz Mayıs Üniversitesi Veteriner Fakültesi ÇİFTÇİ Mustafa Kemal Selçuk Üniversitesi Veteriner Fakültesi ÇOBANOĞLU Özden Uludağ Üniversitesi Veteriner Fakültesi ÇOĞUN Hikmet Yeter Çukurova Üniversitesi Ceyhan Veteriner Fakültesi ÇOLPAN İrfan Ankara Üniversitesi Veteriner Fakültesi DAĞ Serpil Kafkas Üniversitesi Veteriner Fakültesi DALGIN Duygu Ondokuz Mayıs Üniversitesi Veteriner Fakültesi ELMACI Cengiz Uludağ Üniversitesi Ziraat Fakültesi ERALP İNAN Oya Eskişehir Osmangazi Üniversitesi TICAM ERASLAN Gökhan Erciyes Üniversitesi Veteriner Fakültesi ERDOĞAN ATAÇ Funda Ege Üniversitesi Ziraat Fakültesi ERDOĞAN Hidayet Metin Kafkas Üniversitesi Veteriner Fakültesi ERGÜN Yaşar Mustafa Kemal Üniversitesi Veteriner Fakültesi EYDURAN Ecevit Iğdır Üniversitesi Ziraat Fakültesi GENÇOĞLU Hıdır Uludağ Üniversitesi Veteriner Fakültesi GİRGİN Aydın Fırat Üniversitesi Veteriner Fakültesi GÖNCÜOĞLU Muammer Ankara Üniversitesi Veteriner Fakültesi GÜCÜKOĞLU Ali Ondokuz Mayıs Üniversitesi Veteriner Fakültesi GÜL Mehmet Atatürk Üniversitesi Veteriner Fakültesi GÜLBAHAR M. Yavuz Ondokuz Mayıs Üniversitesi Veteriner Fakültesi GÜLŞEN Nurettin Selçuk Üniversitesi Veteriner Fakültesi GÜMÜŞ Hıdır Mehmet Akif Ersoy Üniversitesi Veteriner Fakültesi GÜMÜŞ Recep Cumhuriyet Üniversitesi Veteriner Fakültesi HADİMLİ Hasan Hüseyin Selçuk Üniversitesi Veteriner Fakültesi HATİPOĞLU Fatih Selçuk Üniversitesi Veteriner Fakültesi HAYIRLI Armağan Atatürk Üniversitesi Veteriner Fakültesi ISSA Ghassan İstanbul Avrupa Meslek Yüksek Okulu İLHAN Ziya Yüzüncüyıl Üniversitesi Veteriner Fakültesi İMİK Halit Atatürk Üniversitesi Veteriner Fakültesi İNCE Sinan Afyon Kocatepe Üniversitesi Veteriner Fakültesi KABAK Yonca Betil Ondokuz Mayıs Üniversitesi Veteriner Fakültesi KAÇAR Cihan Kafkas Üniversitesi Veteriner Fakültesi Bu Sayının Hakem Listesi (alfabetik sıra) The Referees List of This Issue (in alphabetical order) KAMİLOĞLU Nadide Nabil Kafkas Üniversitesi Veteriner Fakültesi KAR Sırrı Namık Kemal Üniversitesi Fen Edebiyat Fakültesi KARACA Fikret Mustafa Kemal Üniversitesi Veteriner Fakültesi KARATAŞ STEINUM Süheyla İstanbul Üniversitesi Su Ürünleri Fakültesi KAŞIKÇI Güven İstanbul Üniversitesi Veteriner Fakültesi KAYAR Abdullah İstanbul Üniversitesi Veteriner Fakültesi KEYVAN Erhan Mehmet Akif Ersoy Üniversitesi Veteriner Fakültesi KILIÇARSLAN M. Ragıp İstanbul Üniversitesi Veteriner Fakültesi KIRMIZIGÜL Ali Haydar Kafkas Üniversitesi Veteriner Fakültesi KURT Doğan Dicle Üniversitesi Veteriner Fakültesi KÜPLÜLÜ Özlem Ankara Üniversitesi Veteriner Fakültesi MURUZ Habip Ondokuz Mayıs Üniversitesi Veteriner Fakültesi MUSAL Bayazıt Adnan Menderes Üniversitesi Veteriner Fakültesi NAK Deniz Uludağ Üniversitesi Veteriner Fakültesi NARİNÇ Doğan Namık Kemal Üniversitesi Veteriner Fakültesi ORUÇ Ertan Atatürk Üniversitesi Veteriner Fakültesi ÖZCAN Mukaddes İstanbul Üniversitesi Veteriner Fakültesi ÖZEN Hasan Kafkas Üniversitesi Veteriner Fakültesi ÖZER Kürşat İstanbul Üniversitesi Veteriner Fakültesi ÖZFİLİZ Nesrin Uludağ Üniversitesi Veteriner Fakültesi ÖZKAN Emel Namık Kemal Üniversitesi Ziraat Fakültesi ÖZMEN Özlem Mehmet Akif Ersoy Üniversitesi Veteriner Fakültesi ÖZPINAR Haydar İstanbul Aydın Üniversitesi Mühendislik Fakültesi ÖZYURTLU Nihat Dicle Üniversitesi Veteriner Fakültesi SABUNCUOĞLU ÇOBAN Nilüfer Atatürk Üniversitesi Veteriner Fakültesi SARIEYYÜPOĞLU Mustafa Fırat Üniversitesi Su Ürünleri Fakültesi TAPKI İbrahim Mustafa Kemal Üniversitesi Ziraat Fakültesi TEKE Bülent Ondokuz Mayıs Üniversitesi Veteriner Fakültesi TİMURKAN Sema Fırat Üniversitesi Veteriner Fakültesi TÜRK Necla Bornova Veteriner Kontrol ve Araştırma Enstitüsü UÇAR YILDIRIM Yeliz Erciyes Üniversitesi Veteriner Fakültesi URAL Kerem Adnan Menderes Üniversitesi Veteriner Fakültesi UYAR Cangir Afyon Kocatepe Üniversitesi, Veteriner Fakültesi ÜNAL Nilgün Kırıkkale Üniversitesi Veteriner Fakültesi ÜNVER Ahmet Çanakkale Onsekiz Mart Üniversitesi Tıp Fakültesi ÜTÜK Armağan Erdem Çukurova Üniversitesi Ceyhan Veteriner Fakültesi VATANSEVER Zati Kafkas Üniversitesi Veteriner Fakültesi YILDIRIM Alparslan Erciyes Üniversitesi Veteriner Fakültesi YILDIRIM Funda İstanbul Üniversitesi Veteriner Fakültesi YILDIZ Kader Kırıkkale Üniversitesi Veteriner Fakültesi YILDIZ Ramazan Mehmet Akif Ersoy Üniversitesi Veteriner Fakültesi YILMAZ Oktay Afyon Kocatepe Üniversitesi Veteriner Fakültesi YILMAZ Zeki Uludağ Üniversitesi Veteriner Fakültesi YİĞİT Arzu Kırıkkale Üniversitesi Veteriner Fakültesi ZIK Berrin Uludağ Üniversitesi Veteriner Fakültesi İÇİNDEKİLER (Contents) Sayfa ARAŞTIRMA MAKALELERİ (ReseaRCh aRtiCles) (Page) The Effects of Increase in Threonine to Lysine Ratio on Performance, Blood Parameters and Humoral Immune Responses of Male Broiler Chickens Challenged with Salmonella (Salmonella’ya Maruz Kalan Erkek Broyler Piliçlerde Threonine- Lysine Oranındaki Artışın Performans, Kan Parametreleri ve 165 Humoral İmmun Tepki Üzerine Etkileri) ALIZADE MR, SADEGHI AA, CHAMANI M, SHAWRANG P, KASHAN N (DOI: 10.9775/kvfd.2014.12002) Evaluation of Lead, Cadmium, Arsenic and Mercury Heavy Metal Residues in Fish, Shrimp and Lobster Samples from Persian Gulf (Basra Körfezindeki Balık, Karides ve Istakoz Örneklerinde Kurşun, Kadmiyum, Arsenik ve Civa Ağır Metal Seviyelerinin 173 Değerlendirilmesi) RAHIMI E, GHEYSARI E (DOI: 10.9775/kvfd.2015.13801) Determination of Potential Biomarker among Plasma Sphingosine-1-Phosphate, Total Sialic Acid and Adenosine Deaminase in Cattle with Naturally Infected Liver Cystic Echinococcosis (Doğal Enfekte Karaciğer Kistik Ekinokokozisli Sığırlarda Plazma Sfingosin-1-fosfat, Total Sialik asit ve Adenozindeaminaz 179 Arasından Potansiyel Biomarkerın Belirlenmesi) VAKILI A, AZIMZADEH K, RASOULI S (DOI: 10.9775/kvfd.2015.14027) Semen Characteristics and Cardiac Enzymes in Healthy Male Cats Fed with Commercial Cat Food Containing Yucca schidigera (Yucca schidigera İçeren Ticari Kedi Mamaları ile Beslenen Sağlıklı Erkek Kedilerde Sperma Özellikleri ve Kardiyak Enzim 185 Analizleri) AYDIN VURAL H, BARAN A, BALCI H (DOI: 10.9775/kvfd.2015.14051) Critical Thresholds of Nonesterified Fatty Acids and β-hydroxybutyrate in Transition Dairy Cows for Prediction of First Service Conception Rate (Geçiş Dönemi Sütçü İneklerde İlk Tohumlamada Gebe Kalma Oranını Tahmin Etmede Esterlenmemiş Yağ asitleri ve 191 β-hidroksibütirat Kritik Eşik Değerleri) KARIMI DEHKORDI M, KADIVAR A, TAKTAZ HAFSHEJANI T (DOI: 10.9775/kvfd.2015.14065) The Distribution and Heterogeneity of Mast Cells in the Cecum of Quail (Coturnix coturnix japonica) (Bıldırcın (Coturnix coturnix japonica) Sekumunda Mast Hücrelerinin Dağılımı ve Heterojenitesi) 197 YILDIZ M, AYDEMİR I, KUM Ş, EREN Ü (DOI: 10.9775/kvfd.2015.14084) Thymoquinone, the Main Constituent of Nigella sativa, Could Impact on Adenosine A2 Receptors in Ovalbumin-sensitized Guinea Pigs (Nigella Sativa’nın Biyoaktif Komponenti Olan Timokinon Ovalbuminle Uyarılmış Ginedomuzlarında Adenozin A2 Reseptörlerini 203 Etkileyebilir) MIRZAMOHAMMADI Z, BARADARAN B, SHANEHBANDI D, KEYHANMANESH R, SHAHBAZFAR AA, PEJMAN L (DOI: 10.9775/kvfd.2015.14135) The Effects of Erythropoietin on the Penicillin Induced Epileptiform Activity in Rats (Sıçanlarda Penisilin ile Oluşturulan Epileptiform Aktivitesi Üzerine Eritropoietinin Etkileri) 215 BULUR Ş, DEMİR Ş, BAHADIR A, ANKARALI S, ÖZMERDİVENLİ R, BEYAZÇİÇEK E (DOI: 10.9775/kvfd.2015.14142) The Isolation of Dichelobacter nodosus and Identification by PCR from Ovine Footrot in Kars District, Turkey (Kars Yöresi Koyunlarında Piyeten Olgularından Dichelobacter nodosus İzolasyonu ve PCR İle İdentifikasyonu) 221 ÇELEBİ Ö, OTLU S, BÜYÜK F, ERMUTLU CŞ, GÜLMEZ SAĞLAM A, ÇELİK E, AKÇA D, ŞAHİN M (DOI: 10.9775/kvfd.2015.14205) Effect of Piggery Microclimate on Ejaculate Performance of Artificial Insemination Boars (Mikro Klima İklim Şartlarının Erkek Damızlık Domuzlardaki Ejekulasyon Kalitesine Etkileri) 225 KOWALEWSKI D, KONDRACKI S, GÓRSKI K, BAJENA M, WYSOKIŃSKA A (DOI: 10.9775/kvfd.2015.14229) Presence of Salmonella spp., Listeria monocytogenes, Escherichia coli O157 and Nitrate-Nitrite Residue Levels in Turkish Traditional Fermented Meat Products (Sucuk and Pastırma) (Geleneksel Türk Fermente Et Ürünlerinde (Sucuk ve Pastırma) Salmonella spp., Listeria monocytogenes, Escherichia coli O157 ve 233 Nitrat-Nitrit Varlığı) BÜYÜKÜNAL SK, ŞAKAR FŞ, TURHAN İ, ERGİNBAŞ Ç, SANDIKÇI ALTUNATMAZ S, YILMAZ AKSU F, YILMAZ EKER F, KAHRAMAN T (DOI: 10.9775/kvfd.2015.14238) Isolation and Characterization of Olfactory Stem Cells from Canine Olfactory Mucosa (Köpek Olfaktorik Mukozasindan Olfaktorik Kök Hücrelerin Izolasyonu ve Karakterizasyonu) 237 ALTUNBAŞ K, YAPRAKÇI MV, ÇELİK S (DOI: 10.9775/kvfd.2015.14277) RelA/p65-mediated Innate Immune Response Affecting NDV Replication in CEF (CEF’teki NDV Replikasyonunu Etkileyen RelA/p65-güdümlü Doğal İmmun Tepki) 245 WANG ZX, SUN MH, KANG YF, XIE P, REN T (DOI: 10.9775/kvfd.2015.14340) Effects of Different Levels of Essential Oil Mixed (Peppermint- Thyme-Anise Oil) Supplementation in the Drinking Water on the Growth Performance, Carcass Traits and Histologic Structure of Terminal Ileum in Quails (İçme Suyuna Farklı Düzeylerde İlave Edilen Esansiyel Yağ Karışımının (Nane-Kekik-Anason Yağı) Bıldırcınlarda Büyüme 253 Performansı, Karkas Parametreleri ve İleumun Histolojik Yapısı Üzerine Etkileri) KARADAĞOĞLU Ö, ÖNK K, ŞAHİN T, BİNGÖL SA, ELMALI DA, DURNA Ö (DOI: 10.9775/kvfd.2015.14390) Determination of Iron Deficiency Anemia in Helicobacter Infected Dogs (Helikobakter Enfeksiyonlu Köpeklerde Demir Yetmezliği Anemisinin Belirlenmesii) 261 MERAL Y, DALĞIN D, ÜNLÜ SÖĞÜT M (DOI: 10.9775/kvfd. 2015.14391) Dimetilsülfoksit İlavesi ile Farklı Şekillerde Dondurulmuş Rumen Sıvısının in vitro Sindirim Denemelerinde Kullanım Olanaklarının Araştırılması (An Investigation on Usage of Frozen Rumen Fluid with Adding Dimethylsulfoxide and Different Freezing Methods for 265 Determination of in vitro Digestibility) DENEK N, CAN A, AVCI M (DOI: 10.9775/kvfd. 2015.14414) Evaluation of Serum and Ascitic Fluid Proteomes in Dogs with Dilated Cardiomyopathy (Dilate Kardiyomiyopatili Köpeklerde Serum ve Asites Sıvısı Proteomlarının Araştırılması) 273 KOCATÜRK M, BAYKAL AT, TÜRKSEVEN Ş, ACIOĞLU Ç, AGUDELO CF, YILMAZ Z (DOI: 10.9775/kvfd. 2015.14429) Molecular Prevalence and Haematology of Tropical Theileriosis in Cholistani Cattle from Nomadic Herds of the Cholistan Desert, Pakistan (Pakistan’ın Cholistan Çölünde Başıboş Dolaşan Cholistan Sığırlarında Tropikal Theileriosisin Prevalansı ve Kan Değerleri) 281 SAEED Z, IQBAL F, HUSSAIN M, FAROOQ U, AKBAR A, GULSHER M, MAHMOOD SA, ALI M, SHAIKH RS, AYAZ MM, AKTAS M (DOI: 10.9775/kvfd. 2015.14540) KISA BİLDİRİ (shoRt CommuniCation) An Investigation on the Relationship between the Azoospermia- Like (DAZL) Gene mRNA Expression and the Infertility in Male Cattle-Yak (Sığır-Yak Melezlerinde Azoospermia-Benzeri (DAZL) Gen mRNA Ekspresyon Düzeyi ile İnfertilite Arasındaki İlişki Üzerine 287 Bir Araştırma) HAN Y, FU Y (DOI: 10.9775/kvfd. 2015.13797) Isolation and Identification of High Lactic Acid Producer Bacteria from Forage and Their Silages Grown in Different Ecologies (Farklı Ekolojilerdeki Yem Bitkilerinden ve Silajlarından Yüksek Laktik Asit Üreten Bakteri İzolasyonu ve Tanımlanması) 291 KIZILŞİMŞEK M, KÜSEK M, GEZGİNÇ Y, EROL A (DOI: 10.9775/kvfd. 2015.14291) Serum IL-1β, IL-6, IL-10 and TNF-α Levels in Thyroidectomized Rats (Tiroidektomize Ratlarda Serum IL-1β, IL-6, IL-10 ve TNF-α Seviyeleri) 297 Sinan KANDIR S, Ercan KESKİN E (DOI: 10.9775/kvfd. 2015.14371) A Survey of Crimean-Congo Hemorrhagic Fever in Livestock in Republic of Kosova (Kosova Cumhuriyeti’nde Kırım Kongo Kanamalı Ateşi Üzerine Çiftlik Hayvanlarında Bir Araştırma) 301 SHERIFI S, REXHEPI A, ROBAJ A, HAMIDI A, BEHLULI B, MUSLIU A, EMMERICH P (DOI: 10.9775/kvfd.2015.14406) OLGU SUNUMU (Case RepoRt) Treatment of Complete Urethral Obstruction by using Pneumatic Lithotripsy in a Dog: A Preliminary Report (Bir Köpekte Tam Üretral Obstrüksiyonun Pnömatik Litotripsi İle Tedavisi: İlk Rapor) 305 MADEN M, İDER M, PARLAK K, ÖZTÜRK A (DOI: 10.9775/kvfd.2015.14298) Morphological and Etiological Investigations in A Rotaviral Enteritis Outbreak in Calves (Buzağılarda Gözlenen Bir Rotavirus Enteritis Salgınında Morfolojik ve Etiyolojik Araştırmalar) 309 KALKANOV I, DINEV I, ALEKSANDROV M, DIMITROV K, ZARKOV I (DOI: 10.9775/kvfd.2015.14365) A Rare Complication of the Postpartum Period in a Dog: Vaginal Evisceration (Köpekte Nadir Görülen Bir Postpartum Dönem Komplikasyonu: Vaginal Eviserasyon) 315 ERDOĞAN G, UÇAR EH, KİBAR B, PEKER C, AKKUŞ T (DOI: 10.9775/kvfd.2015.14373) EDİTÖRE MEKTUP (letteR to the editoR) Why Systematic Examination is Important in Diagnosis of Eye Diseases? Lacrimal Punctal Atresia of a Dog Treated When He Reaches the Age of 15 Months (Göz Hastalıklarının Tanısında Sistematik Muayene Neden Önemlidir? Bir Köpekte Ancak 15 Aylık İken Tedavi Edilebilen Atresia 319 Punkta Lakrimalis Olgusu) AVKİ S, YİĞİTARSLAN K (DOI: 10.9775/kvfd.2015.14404) Kafkas Univ Vet Fak Derg KafKas Universitesi veteriner faKUltesi Dergisi 22 (2): 165-172, 2016 JoUrnal Home-Page: http://vetdergi.kafkas.edu.tr Research Article DOI: 10.9775/kvfd.2014.12002 online sUbmission: http://vetdergikafkas.org The Effects of Increase in Threonine to Lysine Ratio on Performance, Blood Parameters and Humoral Immune Responses of Male Broiler Chickens Challenged with Salmonella Mohammad Reza VALIZADE 1,2 Ali Asghar SADEGHI 1 Mohammad CHAMANI 1 Parvin SHAWRANG 3 Nasser KASHAN 1 1 Department of Animal Science, Science and Research Branch, Islamic Azad University, Tehran, IRAN 2 The Health of Plant and Livestock Products Research Center, Mazandaran University of Medical Sciences, Sari, IRAN 3 Nuclear Agriculture Research School, Nuclear Science and Technology Research Institute, Atomic Energy Organization of Iran, Karaj, IRAN Article Code: KVFD-2014-12002 Received: 17.07.2014 Accepted: 10.01.2016 Published Online: 17.01.2016 Abstract The aim of this study was to assess the effect of threonine to lysine (Thr/Lys) ideal ratio for optimum performance, blood parameters and immunity of broiler chicks. Supplemental threonine (equal or 25% more than breed’s threonine/lysine ratio requirement) was added to a control, threonine deficient and high crude fiber diet, then fed to 288 one-day-old male Ross 308 broiler chicks (three treatments and eight replications per treatment). On day 11 and 21 of age, infectious bursal disease virus and infectious bronchitis virus vaccines were orally administered individually, respectively. Then, 21 days after each administration, blood antibody titers against viruses were measured. On day 32 of age, four birds in each treatment group were infected orally with equal numbers of Salmonella Paratyphi A (5×104 cfu/bird). As a result of this study, challenging with Salmonella led to increase in mortality rate and increase in Thr/Lys ratio could not decrease it. Increase in Thr/Lys ratio decreased feed intake and weight gain of ensemble challenged and non- challenged groups, however improved feed conversion ratio of challenged group in finisher period. Feed consumption cost increased by salmonellosis and increase in Thr/Lys ratio could not improve salmonellosis based economic loss. Salmonellosis increased serum urea, uric acid and AST and decreased serum glucose and cholesterol and increase in Thr/Lys ratio did not alleviate triglyceride. Increase in Thr/Lys ratio improved non-significantly humoral immune response in the challenged and non-challenged groups. These findings indicate that higher Thr/Lys ratio in infected birds improved production performance, however could not be an economical lucrative medicative agent. Keywords: Broiler, Humoral immune responses, Lysine, Salmonella, Threonine Salmonella’ya Maruz Kalan Erkek Broyler Piliçlerde Threonine- Lysine Oranındaki Artışın Performans, Kan Parametreleri ve Humoral İmmun Tepki Üzerine Etkileri Özet Bu çalışmanın amacı, etlik piliçlerde ideal lisin (Thr/Lys) oranının optimum performans, kan parametreleri ve immunite üzerine etkisini değerlendirmekti. 288 adet bir günlük erkek Ross 308 etlik civcivlere kontrol, treonin yönünden yetersiz ve yüksek ham selüloz diyetine treonin (türün treonin/lizin oranı gereksinimine eşit veya %25 daha fazla) eklendikten sonra verildi (üç uygulama ve her bir uygulama için sekiz tekrarlı tarzda). Bireylere 11. ve 21. günlükken sırasıyla bulaşıcı bursal hastalık virüsü ve bulaşıcı bronşit virüsü aşıları oral yolla ayrı ayrı uygulandı. Her uygulamadan 21 gün sonra, virüslere karşı kan antikor titreleri ölçüldü. 32 günlükken, her bir tedavi grubundan dört eşit sayıda piliç ağızdan Salmonella Paratyphi A (5 x 104 cfu/piliç) ile enfekte edildi. Bu çalışmanın sonucunda, Salmonella maruziyeti ölüm oranında artışa yol açarken, Thr/Lys oranındaki artış bu oranı azaltamadı. Thr/Lys oranındaki artış maruziyet olan ve olmayan grupların toplam yem alımı ve ağırlık kazançlarını azaltırken, maruziyet grubunun son periyottaki yem dönüşüm oranını artırdı. Yem tüketim maliyeti salmonellosis ile artarken, Thr/Lys oranındaki artış salmonellosis-kökenli ekonomik kaybı azaltamadı. Salmonellosis serum üre, ürik asit ve AST’yi artırıp serum glukoz ve kolesterolü azaltırken, Thr/Lys oranındaki artış ise trigliseridi baskılamadı. Thr/Lys oranındaki artış maruziyet olan ve olmayan gruplardaki humoral immun tepkiyi nispeten yükseltti. Bu bulgular, yüksek Thr/Lys oranının enfekte kuşlardaki üretim performansını artırdığını, ancak ekonomik yönden kazançlı bir tıbbi ajan olamadığını göstermektedir. Anahtar sözcükler: Broyler, Humoral immun tepkiler, Lisin, Salmonella, Treonin  İletişim (Correspondence)  +98 21 44868536  a.sadeghi@srbiau.ac.ir 166 The Effects of Increase in ... INTRODUCTION from entering the food chain; consequently, to improve poultry products consumer’s health [21-23]. Threonine is the third most limiting amino acid in The objective of this study was to determine variations most plant-based broiler diets behind the total sulphur- in performance, blood parameters and humoral immune containing amino acids and lysine [1]. Among the essential responses of broiler chickens challenged with Salmonella amino acids, threonine is particularly important for Paratyphi A, fed diet supplemented with L-Threonine to maintenance of gut barrier integrity and has an important meet various Thr/Lys ratios. role in the structure and function of gastrointestinal tract [2-4]. A higher threonine to lysine (Thr/Lys) ratio in intestinal infected broilers by coccidiosis or subclinical Clostridium MATERIAL and METHODS infection improved production performance [5,6]. The study was approved by the Ethics Committee of Threonine is found in high concentrations in chicken Islamic Azad University, Science and Research Branch gamma globulins [7]. Gamma globulins represent the fraction (approval date: 16.11.2013; no: 3740, AEC 11). of serum containing the highest concentration of immuno- globulins (antibodies) as determined by electrophoresis [8]. Experimental Design and Diets Because immunoglobulins depend on amino acid sequences In a completely randomized design 288 one-day old to form the variable regions for antigen binding and Salmonella negative male (Ross 308) broiler chicks were provide structural support [8], threonine deficiency may randomized in 3 treatments with 8 repetitions, 12 chicks suppress antibody activity [1]. per repeat. Average body weight (means ± standard error) More threonine requirement was reported for optimal of chicks at the beginning of the experiment was 40.3±1.6 g. 2 responses in the cellular and humoral immune systems Chicks were housed in floor pen (10 chicks/1 m pen) and of rats than requirement for optimum growth [9]. Because had free access to feed and water during the experimental of threonine participation in immune system functions period and 24 h light daily in a temperature-controlled and influence of nutrition and vaccination programs on room. The relative humidity was controlled at 65% and diseases prevention, as substitutes for antibiotics, Kidd [1] temperature was set at 32°C on day 1 and lowered recommended such researches should evaluate cellular gradually to 24°C for the rest of the experiment period. and humoral immune system functions as they are affected After 24 h eating similar prestarter pellet, chicks were fed by threonine to understand more completely the birds’ experimental starter (2-10 d), grower (11-24 d) and finisher needs for this essential amino acid [10]. (25-42 d) rations based on breed’s nutritional catalog [11]. Performance assay was accorded with these periods. Low Thr/Lys ratio was reported by Ross broiler nutrition specificatio™n [11] compared with NRC [12]; but, Aviagen [11] Near Infrared Reflectance Spectroscopy (NIRS) reported more threonine to metabolizable energy, lysine (AMINONIR®, 43076) was used to determine amino acids to metabolizable energy, threonine to crude protein and profiles of all ingredients (by: Paya Amin Mehr Co. Ltd., lysine to crude protein for broilers. This means more amino Evonik Animal Nutrition Service, Tehran, Iran). acid intake per daily feed intake [11]. Kidd [1] deduces that Treatment 1 had no threonine supplement, treatment 2 NRC [12] overestimated the threonine requirement of had threonine supplement to meet Thr/Lys ratio requirement broilers (Thr/Lys ratio admittedly) for optimum performance. as pointed in Ross broiler nutrition specification [11] and Likewise, NRC [12] reported that findings about broilers treatment 3 had more threonine supplement to meet Thr requirement was insufficient. Lysine and protein Thr/Lys ratio 25% more. Basal diets ingredients and requirement of modern broiler strains is more than that nutrient analysis and L-Threonine supplement quantity reported by NRC [12] as a result of their fast growth rates. of experimental diets showed in Table 1. The difference Novel researches with new points of view should be done between threonine supplement content of treatments because more Lysine and protein in the diet changes the 1 and 2 with treatment 3, correct with adding grind fine physiological characteristics and quantity of amino acids sand as filler to treatments 1 and 2. requirement [13-19]. Salmonella Challenge and Recovery Salmonella infects poultry and humans by the oral route through contaminated food or water [20]. Salmonella Salmonella enterica subsp. enterica serovar Paratyphi especially Paratyphoid serovar that are motile makes A (ATCC® 9150™) was used for infection induction. This colony on gut epithelium then transmit across from gut bacterium was obtained from microorganism’s bank of mucosal and immune barrier to blood flow and can cause Iranian Biological Resource Centre (IBRC), ACECR, Tehran, septicemia or tissues infection and damage [20]. Today Iran (IBRC No.: IBRC-M 10668). The challenge organism for complementary controls via gut health promotion by non this experiment was grown in tryptic soy broth (Sigma- antibiotic therapy method are used to prevent Salmonella Aldrich, UK) at 37°C then diluted to 5×104 cfu/ml [24]. 167 VALIZADE, SADEGHI, CHAMANI SHAWRANG, KASHAN Table 1. Composition of experimental diets All chickens of four replications of each treatment Tablo 1. Deneysel diyetlerin içeriği individually infected by oral gavage using an animal Starter Grower Finisher feeding needle with equal numbers of Salmonella Paratyphi Items 2-10 d 11-24 d 25-42 d A (5×104 cfu/ml per bird) at the age of 32-d of old [25]. In a Ingredients (g/kg) 2×3 factorial arrangement, other four replications of each Corn 432.91 472.21 503.00 treatment received normal saline. Challenge pens were Wheat 100.00 105.00 105.00 separated by 2 meter distance and separated instrument Barley 50.00 60.00 60.00 from unchallenged pens. Wheat bran 25.00 30.00 30.00 Three cloacae swab samples from each pen of Rice bran 25.00 30.00 30.00 challenged and non-challenged chickens were cultured Soybean meal (46% CP) 311.20 247.00 209.67 on day 39 to confirm that no Salmonella was present in the Soybean oil 6.02 11.45 20.60 unchallenged group and success of Salmonella present in Choline chloride 60% 1.45 1.40 1.30 challenged group. A resistance again tylosin observed in L-Threonine suppl. T-11 - - - an antibiogram test that initially done on this Salmonella L-Threonine suppl. T-21 0.59 0.48 0.36 serovar. Cloacae samples were streaked for isolation onto L-Threonine suppl. T-31 2.81 2.44 2.13 xylose lysine deoxycholate (XLD, Sigma-Aldrich, UK) agar L-Lysine monohydrochloride 2.45 2.20 1.93 plates containing tylosin (20 µg/mL) and incubated for 24 DL- Methionine 2.97 2.40 2.10 and 48 h at 37°C. Plates were evaluated for the presence Limestone 11.84 9.60 9.57 or absence of Salmonella, which grow as red colonies on Dicalcium phosphate 18.15 15.90 14.90 this selective medium [25-27]. Sodium bicarbonate 4.10 3.90 3.70 Salt 0.60 1.00 1.10 Blood Sampling and Measurements Vitamin premix2 2.50 2.50 2.50 Mineral premix2 2.50 2.50 2.50 On days 10, 17, 24, 33 and 42 of age growth efficiency Maduramycin 1% 0.50 0.50 - (all birds/pen) and on day 42, blood parameters (2 birds/ pen) measured. Blood samples (without fasting) had been Analysis results of nutrients caught from wing vein after washing skin with distilled AME 3n (kcal/kg) 2720 2820 2920 water and then drying. Serum glucose, urea, uric acid, CP (%)4 21.074 18.78 17.34 cholesterol, triglyceride and aspartate aminotransferase Thr T. 1 (%) 0.790 0.697 0.641 (AST) measured by human Roche diagnostics kits with Thr T. 2 (%) 0.846 0.743 0.675 automatic analyzer COBAS INTEGRA 400 plus, (Roche Thr T. 3 (%) 1.057 0.929 0.843 Diagnostics Ltd. CH-6343 Rotkreuz, Switzerland). Principle Lys (%) 1.287 1.110 0.994 of these test’s methods was enzymatic-spectrophotometric Thr /Lys T.1 (%) 61.38 62.82 64.47 of hexokinase, urease/glutamate dehydrogenase, uricase/ Thr /Lys T.2 (%) 65.73 66.93 67.91 peroxidase, cholesterol esterase/cholesterol esterase/per- Thr /Lys T.3 (%) 82.16 83.68 84.83 oxidase, Lipoprotein lipase/Glycerol kinase/GPO/Peroxidase Met + Cys (%) 0.965 0.852 0.785 respectively and AST method was according to the IFCC Val (%) 0.990 0.882 0.815 but without P-5’-P [28]. Ile (%) 0.871 0.761 0.693 Arg (%) 1.379 1.201 1.090 Humoral Immune Assay Trp (%) 0.258 0.225 0.204 On day 11 of age, infectious bronchitis H 120 strain live Crude fiber (%) 4.108 3.89 3.70 vaccine product of MERIAL, 17 rue Bourgelat 69002 (Lyon, Ca (%) 0.96 0.80 0.77 France) (Batch no.: L395281) and on day 21 of age, Gumboro Available Phosphorus (%) 0.45 0.40 0.38 D78 live vaccine product of Intervet International B.V. Na (%)5 0.15 0.17 0.16 (Boxmeer, Holland) (Batch no: 12648BM01) were diluted by Cl (%)5 0.15 0.17 0.17 disinfectant-free drinking water then orally administered K (%)5 0.87 0.78 0.71 individually (1.1 dose per chicken). These vaccines were DCAD (meq/kg)5,6 249 224 207 the only vaccine throughout the study. Blood antibody 1 L-Threonine supplement of treatment 1&2&3. Feed grade and 98.5% purity; 2 Breed’s titer against each vaccine measured with ELISA method on special supplement made as Ross nutrition catalog suggested (Anonymous, 2009), contain: 4.400.000 IU/kg of Vit. A, 2.000.000 IU/kg of Vit. D3, 30.000 IU/kg of Vit. E, 1.200 21 days after each administration in serum. Antibody test mg/kg of Vit. K (Menadione), 1.200 mg/kg of B1, 3.200 mg/kg of B2, 24.000 mg/kg of kit used for Infectious Bronchitis Virus (IBV; code: CK119; Nicotinic Acid, 6.000 mg/kg of Pantothenic Acid, 1.600 mg/kg of B6, 60 mg/kg of Biotin, 800 mg/kg of Folic Acid, 6 mg/kg of B12; 6.400 mg/kg of Copper, 500 mg/kg of Iodine, Lot no: FS5674) and Infectious Bursal Disease (IBD; code: 16.000 mg/kg of Iron, 48.000 mg/kg of Manganese, 120 mg/kg of Selenium, 40.000 mg/ CK113; Lot no: FS5709) was product of BioChek veterinary kg of Zinc; 3AMEn: apparent metabolizable energy corrected for nitrogen excretion; 4CP: crude protein; All limiting essential amino acids were supplied in basal diet by increase diagnostics, (BioChek (UK) Ltd., 11 Mill farm business park, in ration crude protein content; 5 by calculation; 6 DCAD: dietary cation anion difference Millfield Road, Hounslow, London TW4 5PY). 168 The Effects of Increase in ... Statistical Analysis one chicken of challenged group in treatment 1 was not infected and no Salmonella were present in unchallenged The statistical normality of all data were tested in group. MINITAB software, confidence level=95% [29]. Statistical normal data of each variable with normal distribution Performance (P>0.05) used for ANOVA procedure and statistical un- normal data (P<0.05) normalized by especial equations Salmonellosis led to increase (P<0.01) in mortality according to each variable properties [29,30]. Then treatments and addition of Thr level did not alleviate it significantly analyzed by ANOVA procedure using the GLM procedure (Table 2). Feed intake (FI) was not affected by salmonellosis of SAS software [31]. When significant differences among significantly; but, the increase in Thr/Lys ratio over catalog means were found, means were separated using Duncan’s recommendation decreased (P<0.05) feed intake in whole Multiple Comparison test (α=5%) for post hoc multiple period (Table 3). Salmonellosis and addition of Thr/Lys comparisons. ratio over catalog recommendation decreased (P<0.05) weight gain (Table 2, Table 3). In Salmonella positive group, RESULTS recommended Thr/Lys ratio increased (P<0.05) weight gain than other Thr/Lys ratio level (Table 3); but, increase Salmonella Recovery in Thr/Lys ratio in Salmonella positive group at finisher period did not improve weight gain significantly (Table Salmonella culture of cloacae samples showed that only 2). Feed conversion ratio (FCR) and protein efficiency ratio Table 2. Response to different Thr/Lys ratio and Salmonella challenge for performance Tablo 2. Farklı Thr/Lys oranı ve Salmonella maruziyetine karşı performans tepkisi Starter (2-10 d) Grower (11-24 d) Finisher (25-42 d) Traits1 Mortality FI WG FCR Mortality FI WG Mortality FI WG% (kg) (kg) % (kg) (kg) FCR % (kg) (kg) FCR Treatments2 T.1 2.59 0.272 0.218 1.255 3.89 1.532ab 0.943ab 1.624 4.77b 2.546 1.327a 1.918c T.2 0.00 0.271 0.224 1.212 5.19 1.588a 0.997a 1.593 0.00b 2.553 1.311a 1.932c T.3 0.00 0.269 0.216 1.255 4.02 1.463b 0.901b 1.626 0.00b 2.453 1.340a 1.831c T.4 - - - - - - - - 19.09a 2.526 1.005b 2.509a T.5 - - - - - - - - 19.39a 2.590 1.076b 2.405ab T.6 - - - - - - - - 19.09a 2.397 1.034b 2.320b Factors3 Sal. - - - - - - - - - 1.59b 2.511 1.326a 1.894b Sal. + - - - - - - - - 19.19a 2.504 1.038b 2.412a Thr.1 - - - - - - - - 10.90 2.537 1.210 2.171a Thr.2 - - - - - - - - 8.31 2.557 1.209 2.135a Thr.3 - - - - - - - - 8.18 2.429 1.189 2.040b SEM4 Treatments 0.522 0.002 0.003 0.016 1.003 0.015 0.011 0.006 3.496 0.073 0.022 0.041 Sal. - - - - - - - - 2.018 0.042 0.013 0.023 Thr. - - - - - - - - 2.472 0.051 0.16 0.029 P-value5 Treatments 0.119 0.906 0.657 0.516 0.863 0.017 0.021 0.150 0.001 0.614 0.0001 0.0001 Sal. - - - - - - - - 0.0001 0.925 0.0001 0.0001 Thr. - - - - - - - - 0.781 0.221 0.523 0.022 Sal.×Thr. - - - - - - - - 0.756 0.769 0.204 0.388 CV6 295.8 4.48 8.53 6.33 112.4 4.81 6.14 2.06 76.55 5.85 3.78 3.90 1 FI: Feed Intake (kg/41d), WG: Weight Gain (kg/41d), FCR: Feed Conversion Ratio (feed intake/weight gain); 2 Comparison of treatments effects: T.1 = Low Thr/ Lys ratio+ no Salmonella challenge, T.2 = Standard Thr/Lys ratio + no Salmonella challenge, T.3 = High Thr/Lys ratio+ no Salmonella challenge, T.4 = Low Thr/ Lys ratio + Salmonella challenge, T.5 = Standard Thr/Lys ratio + Salmonella challenge, T.6= High Thr/Lys ratio + Salmonella challenge; 3 Comparison of factors effects: Sal. - = Salmonella negative group, Sal. + = Salmonella positive group, Thr.1 = Low Thr/Lys ratio group, Thr.2 = Standard Thr/Lys ratio group, Thr.3= High Thr/Lys ratio group; 4 Standard error of mean for treatments or factors (Sal. = Salmonella grouping; Thr. = Threonine grouping); 5 Significance level of calculated F in analysis of variance; 6 Coefficient of variation (%); abc Means without a common superscript letter differ within each part of a column (P<0.05) 169 VALIZADE, SADEGHI, CHAMANI SHAWRANG, KASHAN Table 3. Response to different Thr/Lys ratio and Salmonella challenge (whole period) Tablo 3. Farklı Thr/Lys oranı ve Salmonella maruziyetine karşı tepki (tüm periyot) Traits1 Mortality FI WG FCR FCC PER IBV IBD Urea Uric acid AST Glucose Chol. Trig. % (kg) (kg) (USD $) titer titer (mg/dL) (mg/dL) (IU/L) (mg/dL) (mg/dL) (mg/dL) Treatments2 T.1 9.3ab 4.393 2.519a 1.743b 0.691b 3.125a 1412.5 4475.3 2.83b 2.97c 292.5bc 236.4ab 132.8 114.1 T.2 9.0ab 4.412 2.553a 1.727b 0.686b 3.154a 1368.8 4093.7 2.95b 3.53bc 282.2c 228.1ab 136.7 145.2 T.3 4.7b 4.250 2.513a 1.691b 0.680b 3.222a 1505.0 4780.6 3.12b 3.37c 309.3bc 264.0a 148.2 138.3 T.4 21.2a 4.276 2.126c 2.009a 0.796a 2.717b 1235.6 3879.6 4.17a 3.89abc 370.1ab 198.8b 118.9 104.9 T.5 24.2a 4.425 2.271b 1.946a 0.773a 2.805b 1203.9 3561.6 4.34a 4.61a 358.8abc 192.4b 122.7 136.4 T.6 21.2a 4.046 2.077c 1.951a 0.785a 2.799b 1320.9 4162.9 4.58a 4.37ab 393.4a 222.5ab 132.7 127.0 Factors3 Sal. - 7.7b 4.351 2.528a 1.720b 0.686b 3.167a 1428.8 4449.9 2.97b 3.29b 294.6b 242.8a 139.2a 132.6 Sal. + 22.2a 4.249 2.158b 1.969a 0.785a 2.773b 1253.5 3868.0 4.36a 4.29a 374.1a 204.6b 124.8b 122.7 Thr.1 14.4 4.343ab 2.351ab 1.857 0.736 2.950 1336.7 4220.0 3.40 3.37 325.7 220.2 126.8 110.2b Thr.2 15.5 4.418a 2.432a 1.821 0.724 3.004 1298.1 3865.6 3.55 4.00 315.0 212.8 130.7 141.5a Thr.3 11.8 4.162b 2.326b 1.802 0.725 3.040 1426.1 4515.9 3.74 3.80 345.3 246.2 141.5 133.5a SEM4 Treatments 4.25 0.088 0.039 0.024 0.009 0.033 238.0 348.3 0.24 0.28 24.8 14.7 6.8 9.4 Sal. 2.45 0.051 0.022 0.014 0.005 0.019 137.4 201.1 0.13 0.16 14.3 8.5 3.9 5.4 Thr. 3.00 0.062 0.027 0.017 0.006 0.023 168.2 246.3 0.17 0.20 17.5 10.4 4.8 6.7 P-value5 Treatments 0.037 0.117 0.0001 0.0001 0.0001 0.0001 0.963 0.273 0.0001 0.004 0.026 0.034 0.101 0.061 Sal. 0.001 0.210 0.0001 0.0001 0.0001 0.0001 0.409 0.066 0.0001 0.0003 0.0009 0.005 0.022 0.248 Thr. 0.726 0.036 0.037 0.139 0.398 0.069 0.880 0.243 0.411 0.117 0.511 0.107 0.139 0.011 Sal.×Thr. 0.878 0.536 0.209 0.641 0.611 0.562 0.999 0.993 0.973 0.964 0.988 0.983 0.993 0.991 CV6 60.9 4.11 3.33 2.70 2.66 2.20 49.73 23.45 19.10 21.65 21.35 18.42 14.59 20.88 1 FI: Feed Intake (kg/41d), WG: Weight Gain (kg/41d), FCR: Feed Conversion Ratio (feed intake/weight gain), FCC: Feed Consumption Cost (cost of feed intake in Rials/kg of weight gain), PER: Protein Efficiency Ratio (kg of weight gain/kg of consumed crude protein), IBV titer: ELISA titer of Infectious Bronchitis Virus, IBD titer: ELISA titer of Infectious Bursal Disease, Chol.: Cholesterol, Trig.: Triglycerides; 2 Comparison of treatments effects: T.1 = Low Thr/Lys ratio + no Salmonella challenge, T.2 = Standard Thr/Lys ratio + no Salmonella challenge, T.3 = High Thr/Lys ratio + no Salmonella challenge, T.4= Low Thr/Lys ratio + Salmonella challenge, T.5 = Standard Thr/Lys ratio + Salmonella challenge, T.6= High Thr/Lys ratio + Salmonella challenge; 3 Comparison of factors effects: Sal. - = Salmonella negative group, Sal. + = Salmonella positive group, Thr.1 = Low Thr/Lys ratio group, Thr.2 = Standard Thr/Lys ratio group, Thr.3 = High Thr/Lys ratio group; 4 Standard error of mean for treatments or factors (Sal. = Salmonella grouping; Thr. = Threonine grouping); 5 Significance level of calculated F in analysis of variance; 6 Coefficient of variation (%); abc Means without a common superscript letter differ within each part of a column (P< 0.05) (PER) negatively affected (P<0.01) by salmonellosis (Table considerable and recommended Thr/Lys ratio by catalog 3). Improved FCR and PER by adding Thr to basal diet was has the best FCR non-significantly (Table 2). inconsiderable in whole period but Thr/Lys ratio over catalog recommendation in Salmonella positive group at Blood Parameters finisher improved (P<0.01) FCR than lowest Thr/Lys ratio Salmonellosis increased serum urea, uric acid and AST (Table 2). Salmonellosis led to increase (P<0.01) in feed and decreased serum glucose and cholesterol (P<0.01). consumption cost per 1 kg weight gain (Table 3). Salmonellosis did not decrease serum triglycerides significantly. A non-significant trend in challenged and Improved feed consumption cost (FCC) by increasing non-challenged groups was observed between increasing Thr/Lys ratio was inconsiderable. Results on mortality, Thr/Lys ratio and increased serum urea and uric acid. feed intake, weight gain and FCR at starter and grower are Increasing Thr/Lys ratio had no significant incremental given in Table 2. A trend (P<0.05) was observed between effect on serum AST and glucose but ratio 25% over catalog increases in Thr/Lys ratio over catalog recommendation recommendation led to a small increasing in challenged and decrease in feed intake and weight gain at grower and non-challenged groups. Increasing Thr/Lys ratio led (Table 2). At grower negative effect of maximum Thr/ to increase (P<0.05) in serum triglyceride but the similar Lys ratio than catalog recommendation on FCR was in- effect on cholesterol was not significant. 170 The Effects of Increase in ... Humoral Immune Response beneficial metabolic effect of threonine, like on immune response to Salmonella infection as coccidiosis challenge [6]. Decreased humoral immune response by salmonellosis was not significant. Increasing Thr/Lys ratio over catalog Some animals, like rats and pigs, have a specific recommendation did not improve humoral immune requirement for threonine to optimize immunity that response in challenged and non-challenged groups. is much higher than that of growth [9,40,41]. In the present investigation no differences in humoral immunity or DISCUSSION mortality were observed in challenged and non challenged groups in response to different Thr/Lys ratios. Similar Salmonellosis inducted by Salmonella Paratyphi A, investigations reported that high Thr/Lys ratio over (well- negatively affected production performance (similar to nigh) Ross nutrition specification recommendation had no Clostridium infection) and mortality rate and increasing Thr/ significant effect on improvement of cellular or humoral [2,42,43] Lys ratio over catalog recommendation could not improve immunity . Nevertheless, improved cellular or humoral them significantly [5]. However, a trend (P<0.05) was observed immunity in response to increased Thr/Lys ratio were between increase in Thr/Lys ratio and improvement of FCR reported in diets with great Thr deficiency and more in finisher period that may be because of its small negative threonine supplementing than recommended Thr/Lys ratio effect on feed intake and obtained similar weight gain. by Ross nutrition specification had no significant effect [4,5,44]. In whole period, recommended Thr/Lys ratio by catalog Identification of the arginine pathway that produces showed increase in feed intake and weight gain than nitric oxide has led to research demonstrating that Arg is [45] level 25% more, that was also significant in weight gain a potent immunological modulator . Animal and human of infected chickens (Table 3). Weight gain of infected studies suggest outcome benefit to the use of supplemental chickens fed recommended Thr/Lys ratio by catalog was dietary arginine [46]. Complimentary effects of arginine on immune function and health of broiler chickens showed more than other levels, similar to Clostridium infected [5,32] high levels of Arginine accelerated antibody production [47]. chicken . This is may be because low Thr and high Thr led Depressed kidney arginase activity by feeding high level to amino acid imbalance and amino acid imbalance led to of threonine was reported that may leading to more bio- decreased feed intake and weigh gain and impairment of [33-35] availability of arginine for immune responses and less urea FCR . Therefore, recommended Thr/Lys ratio by catalog excretion in chickens [48,49]. In the present study no decrease seems to be adequate for optimum performance [11]. in serum urea in response to increased diets Thr level were Increase in diet’s crude fiber can affect intestinal mucosa observed, whereas serum urea showed a non-significant and consequently digestive tract health that may lead to incremental trend. More investigation about relationship gut susceptibility to infections [36,37]. Therefore, with the aim between arginase activity and threonine levels on immune of increasing diet’s crude fiber and decreasing threonine response alteration mechanism is recommendable. content of treatment 1 as far as possible, the basal diet was No significant negative effect of highest examined Thr formulated in total amino acids system on base of corn, level on AST was observed. Correlation with no significant wheat, barley, wheat bran, rice bran and soybean meal. alteration of serum glucose and cholesterol, showed highest It is known that a threonine deficiency will affect mucin examined Thr level might have had no adverse effect on secretion and, thereby, gut barrier integrity [38]. Mucus liver functions. Significant increased of serum triglycerides contains relatively high threonine levels, suggesting that in response to increased Thr/Lys ratio on ensemble the threonine requirement in birds with intestinal problems challenged and non-challenged groups might indicate on may increase [3]. European Centre for Disease Prevention better absorption of triglycerides from healthier absorptive and Control [39] reported Salmonella Paratyphi A was the surface. most commonly identified serotype in human cases of paratyphoid fever in EU/EEA countries. Because of Increase in Thr/Lys ratio 25% over catalog recommen- epidemiological importance of this serovar around the dation could slightly be economically lucrative; however, Thr/ world, this serovar was selected for study. In the present Lys ratio 25% over catalog recommendation significantly study, FCR and PER generally not improved by increasing improved FCR compare with Thr deficient diet in Salmonella Thr/Lys ratio. In Salmonella challenge group, that may be challenged group. In severe gastric infection that leading because of severity of inducted infection by this Salmonella to mortality, increasing Thr/Lys ratio over catalog recom- serovar similar to Clostridium infected chicken or relatively mendation seemed to have inconsiderable effect on few differences between Thr/Lys ratios of basal diets and subjugating the infection and seems cannot be a choice recommended Thr/Lys ratio [5,6]. Nevertheless this general for replacing the antibiotics. resulting, FCR of challenged group in finisher period tended to improve with increasing Thr/Lys ratio; however, no Acknowledgment significant effects on feed intake or weight gain of these chickens were observed. This may be because of other The authors are grateful to the Islamic Azad University 171 VALIZADE, SADEGHI, CHAMANI SHAWRANG, KASHAN for research funding support. Also we thank Samia 18. Baylan M, Canogullari S, Ayasan T, Sahin A: Dietary threonine Momeni Ahangar expert of Babol Razi Pathobiology Lab supplementation for improving growth performance and edible carcass parts in japanese quails, Coturnix coturnix japonica. Int J Poult Sci, 5, 635- (Babol, Iran) to carry out biochemistry tests and Dr. Marjan 638, 2006. DOI: 10.3923/ijps.2006.635.638 Tafreshi expert of Dr. Rohani veterinary hospital (Babol, 19. Canogullari S, Baylan M, Ayasan T: Threonine requirement of laying Iran) to carry out humoral immune tests. japanese quails. J Anim Vet Adv, 8, 1539-1541, 2009. 20. Gast RK: Paratyphoid infections. In, Saif YM (Ed): Diseases of Poultry. REFERENCES 12th ed., 636-665. Blackwell Publishing Professional, 2121 State Avenue, Ames, Iowa 50014, USA, 2008. 1. Kidd MT: Nutritional considerations concerning threonine in broilers. 21. Berndt A, Wilhelm A, Jugert C, Pieper J, Sachse K, Methner U: World’s Poult Sci J, 56, 139-151, 2000. DOI: 10.1079/WPS20000011 Chicken cecum immune response to Salmonella enterica Serovars of 2. Abbasi MA, Mahdavi AH, Samie AH, Jahanian R: Effects of different different levels of invasiveness. Infect Immunol, 75, 5993-6007, 2007. DOI: levels of dietary crude protein and threonine on performance, humoral 10.1128/IAI.00695-07 immune responses and intestinal morphology of broiler chicks. Braz J 22. Chambers JR, Gong J: The intestinal microbiota and its modulation Poult Sci, 16, 35-44, 2014. DOI: 10.1590/S1516-635X2014000100005 for Salmonella control in chickens. Food Res Int, 44, 3149-3159, 2011. DOI: 3. Bertolo RFP, Chen CZL, Law G, Pencharz PB, Ball RO: Threonine 10.1016/j.foodres.2011.08.017 requirement of neonatal piglets receiving total parental nutrition 23. Lorenzoni G: Poultry diseases influenced by gastrointestinal health: is considerably lower than that of piglets receiving an identical diet Traditional treatments and innovative solutions. 73-78. Nottingham intragastrically. J Nutr, 128, 1752-1759, 1998. University Press, Nottingham, NG11 0AX, United Kingdom, 2010. 4. Wils-Plotz EL, Dilger RN: Combined dietary effects of supplemental 24. Kallapura G, Morgan MJ, Pumford NR, Bielke LR, Wolfenden AD, threonine and purified fiber on growth performance and intestinal health Faulkner OB, Latorre JD, Menconi A, Hernandez-Velasco X, Kuttappan of young chicks. Poult Sci, 92, 726-734, 2013. DOI: 10.3382/ps.2012-02664 VA, Hargis BM, Tellez G: Evaluation of the respiratory route as a viable 5. Star L, Rovers M, Corrent E, van der Klis JD: Threonine requirement portal of entry for Salmonella in poultry via intratracheal challenge of of broiler chickens during subclinical intestinal Clostridium infection. Salmonella Enteritidis and Salmonella Typhimurium. Poult Sci, 93, 340- Poult Sci, 91, 643-652, 2012. DOI: 10.3382/ps.2011-01923 346, 2014. DOI: 10.3382/ps.2013-03602 6. Wils-Plotz EL, Jenkins MC, Dilger RN: Modulation of the intestinal 25. Higgins SE, Wolfenden AD, Tellez G, Hargis BM, Porter TE: environment, innate immune response, and barrier function by dietary Transcriptional profiling of cecal gene expression in probiotic and threonine and purified fiber during a coccidiosis challenge in broiler Salmonella challenged neonatal chicks. Poult Sci, 90, 901-913, 2011. DOI: chicks. Poult Sci, 92, 735-745, 2013. DOI: 10.3382/ps.2012-02755 10.3382/ps.2010-00907 7. Tenenhouse HS, Deutsch HF: Some physical-chemical properties 26. Doyle MP, Busta F, Cords BR, Davidson PM, Hawke J, Hurd HS, of chicken gamma-globulins and their pepsin and papain digestion Isaacson RE, Matthews K, Maurer J, Meng J, Montville TJ, Shryock TR, product. Immunochemistry, 3, 11-20, 1966. Sofos JN, Vidaver AK, Vogel L: Antimicrobial resistance: Implications for the food system. Comp Rev Food Sci Food Safety, 5, 71-137, 2006. DOI: 8. Tizzard IR: The nature of antibodies. In, Tizard IR (Ed): Immunology: 10.1111/j.1541-4337.2006.00004.x An Introduction. 3rd ed., 145-166, Saunders College Publishing, New York, 1992. 27. Park SH, Ryu S, Kang DH: Development of an improved selective and differential medium for isolation of Salmonella spp. J Clin Microbiol, 9. Lotan R, Mokady S, Horenstein L: The effect of lysine and threonine 50, 3222-3226, 2012. DOI: 10.1128/JCM.01228-12 supplementation on the immune response of growing rats fed wheat gluten diets. Nutr Rep Int, 22, 313-318, 1980. 28. Bergmeyer HU, Hørder M, Rej R: Approved recommendation (1985) on IFCC methods for the measurement of catalytic concentration of 10. Ayasan T, Okan F: Effects of diets containing different levels of enzymes. Part 2. IFCC method for aspartate aminotransferase. J Clin Chem threonine and lysine amino acids on fattening performance of broiler Clin Biochem, 24, 497-510, 1986. chicks. Süleyman Demirel Üniv Ziraat Fak Derg, 5, 36-43, 2010. 29. Minitab Inc: Statistical software, Release 14.1. Minitab Inc, Pennsylvania 11. Anonymous: Ross nutrition supplement. 21. Aviagen Technical State College, USA, 2003. Service, Newbridge, Midlothian, EH28 8SZ, Scotland, UK, 2009. th 30. Festing MFW, Altman DC: Guidelines for the design and statistical 12. NRC: Nutrient requirements of poultry. 9 rev. ed., National Academy analysis of experiments using laboratory animals. ILAR J, 43, 244-258, Press, Washington, DC, 1994. DOI: 10.17226/2114 2002. DOI: 10.1093/ilar.43.4.244 13. Berres J, Vieira SL, Favero A, Freitas DM, Pena JEM, Nogueira 31. SAS Institute: SAS/STAT User’s guide, Version 9.1. SAS Institute Inc. ET: Digestible valine requirements in high protein diets for broilers from Cary, NC, 2002. twenty-one to forty-two days of age. Anim Feed Sci Technol, 165, 120-124, 2011. DOI: 10.1016/j.anifeedsci.2011.01.001 32. Lensing M, Van Der Klis JD, Le Bellego L, Rovers M: The threonine requirement of broiler chickens during subclinical intestinal infection. 14. Gong LM, Lai CH, Qiao SY, Li D, Ma YX, Liu YL: Growth performance, In, Proceedings of the 16th European Nutrition Symposium. 343-346. World’s carcass characteristics, nutrient digestibility and serum biochemical Poultry Science Association Strasbourg, France, 2007. parameters of broilers fed low-protein diets supplemented with various ratios of threonine to lysine. Asian-Aust J Anim Sci, 18, 1164-1170, 2005. 33. Boorman KN, Ellis GM: Maximum nutritional response to poor DOI: 10.5713/ajas.2005.1164 quality protein and amino acid utilization. Br Poult Sci, 37, 145-156, 1996. DOI: 10.1080/00071669608417844 15. Hurwitz S, Sklan D, Talpaz H, Plavnik I: The effect of dietary protein level on the lysine and arginine requirements of growing chickens. Poult 34. Denbow DM: Food intake control in birds. Neurosci Biobehav Rev, Sci, 77, 689-696, 1998. DOI: 10.1093/ps/77.5.689 9, 223-232, 1985. DOI: 10.1016/0149-7634(85)90047-8 16. Morris TR, Gous RM, Fisher C: An analyses of the hypothesis that 35. Zaefarian F, Zaghari M, Shivazad M: The threonine requirements amino acid requirements for chicks should be stated as a proportion and its effects on growth performance and gut morphology of broiler of dietary protein. World’s Poult Sci J, 55, 7-22, 1999. DOI: 10.1079/ chicken fed different levels of protein. Int J Poult Sci, 7, 1207-1215, 2008. WPS19990002 DOI: 10.3923/ijps.2008.1207.1215 17. Plumstead PW, Romero-Sanchez H, Paton ND, Spears JW, Brake 36. Montagne L, Piel C, Lalles JP: Effect of diet on mucin kinetics and J: Effects of dietary metabolizable energy and protein on early growth composition: Nutrition and health implications. Nutr Rev, 62, 105-114, responses of broilers to dietary lysine. Poult Sci, 86, 2639-2648, 2007. 2004. DOI: 10.1111/j.1753-4887.2004.tb00031.x DOI: 10.3382/ps.2007-00168 37. Montagne L, Pluske JR, Hampson DJ: A review of interactions 172 The Effects of Increase in ... between dietary fibre and the intestinal mucosa, and their consequences ps/76.4.608 on digestive health in young non-ruminant animals. Anim Feed Sci Techn, 43. Kidd MT, Gerard PD, Heger J, Kerr BJ, Rowe D, Sistani K, Burnham 108, 95-117, 2003. DOI: 10.1016/S0377-8401(03)00163-9 DJ: Threonine and crude protein responses in broiler chicks. Anim Feed 38. Horn NL, Donkin SS, Applegate TJ, Adeola O: Intestinal mucin Sci Technol, 94, 57-64, 2001. DOI: 10.1016/S0377-8401(01)00301-7 dynamics: Response of broiler chicks and White Pekin ducklings to dietary 44. Ayasan T, Okan F, Hizli H: Threonine requirement of broiler from 22- threonine. Poult Sci, 88, 1906-1914, 2009. DOI: 10.3382/ps.2009-00009 42 days. Int J Poult Sci, 8, 862-865, 2009. DOI: 10.3923/ijps.2009.862.865 39. European Centre for Disease Prevention and Control: Annual 45. Collier J, Vallance P: Second messenger role for NO widens to epidemiological report, 2012. 122-125. Stockholm, ECDC, 2013. DOI: nervous and immune systems. Trends Pharmacol Sci, 10, 427-431, 1989. 10.2900/76137 DOI: 10.1016/S0165-6147(89)80001-X 40. Defa L, Changting X, Shiyan Q, Jinhui Z, Johnson EW, Thacker 46. Evoy D, Lieberman MD, Fahey TJ: Immunonutrition: The role of PA: Effects of dietary threonine on performance, plasma parameters and immune function of growing pigs. Anim Feed Sci Tech, 78, 179-188, 1999. arginine. Nutr, 14, 611-617, 1998. DOI: 10.1016/S0899-9007(98)00005-7 DOI: 10.1016/S0377-8401(99)00005-X 47. Abdukalykova S, Ruiz-Feria CA: Arginine and vitamin E improve 41. Wang X, Qiao SY, Liu M, Ma YX: Effects of graded levels of true ileal the cellular and humoral immune response of broiler chickens. Int J Poult digestible threonine on performance, serum parameters and immune Sci, 5, 121-127, 2006. DOI: 10.3923/ijps.2006.121.127 function of 10-25 kg pigs. Anim Feed Sci Tech, 129, 264-278, 2006. DOI: 48. Austic RE, Nesheim MC: Role of kidney arginase in variations of the 10.1016/j.anifeedsci.2006.01.003 arginine requirement of chicks. J Nutr, 100, 855-868, 1970. 42. Kidd MT, Kerr BJ, Anthony NB: Dietary interactions between lysine 49. Austic RE, Scott RL: Involvement of food intake in the lysine-arginine and threonine in broilers. Poult Sci, 76, 608-614, 1997. DOI: 10.1093/ antagonism in chicks. J Nutr, 105, 1122-1131, 1975. Kafkas Univ Vet Fak Derg KafKas Universitesi veteriner faKUltesi Dergisi 22 (2): 173-178, 2016 JoUrnal Home-Page: http://vetdergi.kafkas.edu.tr Research Article DOI: 10.9775/kvfd.2015.13801 online sUbmission: http://vetdergikafkas.org Evaluation of Lead, Cadmium, Arsenic and Mercury Heavy Metal Residues in Fish, Shrimp and Lobster Samples from Persian Gulf [1] Ebrahim RAHIMI 1 Elham GHEYSARI 2 [1] This work was supported by the Islamic Azad University, Shahrekord Branch, Shahrekord, Iran, grant no. 94/912045 1 Department of Food Hygiene and Public Health, College of Veterinary Medicine, Islamic Azad University, Shahrekord, IRAN 2 Department of Food Science and Technology, College of Agriculture, Islamic Azad University, Shahrekord, IRAN Article Code: KVFD-2015-13801 Received: 01.06.2015 Accepted: 17.09.2015 Published Online: 29.09.2015 Abstract Severe discharge of sewage and industrial effluents into the Persian Gulf causes the deposition of various types of heavy metals and especially lead, cadmium, arsenic and mercury in the muscles of marine animals. The present study was carried out to evaluate the concentration of lead, cadmium, arsenic and mercury in the fish (Scomberomorus commerson), shrimp (Fenneropenaeus indicus) and lobster (Panulirus homarus) samples from Persian Gulf. All of the samples were collected from the shopping centers in the Boushehr city. Weight and length of samples were measured and recorded. Concentrations of lead, cadmium, arsenic and mercury in fish, shrimp and lobster samples were analyzed using atomic absorption spectrophotometer. Average length and weight of collected samples were 46.9±2.68 cm and 642.237±52 g for fish, 18.88±1.67 cm and 45.779±4.51 g for shrimp and 22.3±2.13 cm and 203.098±20 g for lobster. Heavy metals concentrations in fish samples were 91.67±9.21 for lead, 49.00±4.77 for mercury, 60.37±7.07 for cadmium and 101.33±9.85 μg/g for arsenic. Lead, mercury, cadmium and arsenic concentration ranges were 64-93, 104-135, 18-34 and 211-265 μg/g in shrimp and 260-390, 71-130, 114-348 and 118-318 μg/g in lobster, respectively. ANOVA test showed significant statistically differences (P<0.05) between the type of seafoods and concentration of heavy metals. However, the levels of toxic elements were less than allowable concentrations but consumption of the contaminated seafoods with low levels of heavy metals may be harmful for human health. Keywords: Arsenic, Lead, Mercury, Cadmium, Persian Gulf, Seafood Basra Körfezindeki Balık, Karides ve Istakoz Örneklerinde Kurşun, Kadmiyum, Arsenik ve Civa Ağır Metal Seviyelerinin Değerlendirilmesi Özet İran Körfezine aşırı miktarda lağım ve endüstriyel atığın salınması çeşitli ağır metallerin ve özellikle de kurşun, kadmiyum, arsenik ve cıvanın sucul canlıların kaslarında birikmesine neden olmaktadır. Mevcut çalışma, İran Körfezindeki balık (Scomberomorus commerson), karides (Fenneropenaeus indicus) ve ıstakoz (Panulirus homarus) örneklerinde kurşun, kadmiyum, arsenik ve cıva ağır metal konsantrasyonlarının belirlenmesi amacıyla gerçekleştirildi. Tüm örnekler Boushehr şehrindeki alışveriş merkezlerinden toplandı. Örneklerin ağırlık ve uzunlukları ölçülerek kaydedildi. Balık, karides ve ıstakoz örneklerinde kurşun, kadmiyum, arsenik ve cıva ağır metal konsantrasyonları atomik absorpsiyon spektrofotometre ile belirlendi. Ortalama uzunluk ve ağırlıklar sırasıyla balıkta 46.9±2.68 cm ve 642.237±52 g, karideste 18.88±1.67 cm ve 45.779±4.51 g ve ıstakozda 22.3±2.13 cm ve 203.098±20 g olarak kaydedildi. Balık örneklerindeki ağır metal seviyeleri kurşun için 91.67±9.21, cıva için 49.00±4.77, kadmiyum için 60.37±7.07 ve arsenik için 101.33±9.85 μg/g olarak tespit edildi. Kurşun, cıva, kadmiyum ve arsenik konsantrasyonları karideste sırasıyla 64-93, 104-135, 18-34 ve 211-265 μg/g ıstakozda ise 260-390, 71-130, 114-348 ve 118-318 μg/g değerleri arasında belirlendi. ANOVA testi deniz ürünleri ve ağır metal konsantrasyonları yönünden istatistiksel olarak anlamlı farlılıkların olduğunu gösterdi (P<0.05). Toksik maddelerin seviyeleri izin verilen seviyenin altında olmasına rağmen düşük düzeyde ağır metal ile kontamine deniz ürünlerinin tüketilmesi insan sağlığı açısından tehlikeli olabilir. Anahtar sözcükler: Arsenik, Kurşun, Cıva, Kadmiyum, İran Körfezi, Deniz ürünü  İletişim (Correspondence)  +98 913 3278377  elhamgheysari7@yahoo.com 174 Evaluation of Lead, Cadmium, ... INTRODUCTION recently from the Persian Gulf. All samples were maintained in cold box and transferred to the laboratory at 4°C. Seafoods such as fish, shrimp and lobster provide Total length (cm) and body weight (g) of the samples were essential nutrients for the human nutrition. They contain measured and recorded before dissection. Average length complete proteins, vitamins and minerals which are and weight of collected samples were 46.9±2.68 cm and considered to be major dietary compounds for the health, 642.237±52 g for fish (Scomberomorus commerson), in particular, including high levels of polyunsaturated fatty 18.88±1.67 cm and 45.779±4.51 g for shrimp (Fenneropenaeus acids such as omega-3 and omega-6. Tens of millions of indicus) and 22.3±2.13 cm and 203.098±20 g for lobster people consume these products daily. This situation makes (Panulirus homarus). The muscle samples were maintained the quality of the seafoods much more important for the in −20°C freezer prior to analysis. public health. Otherwise, the seafoods may be potential Devices, Reagents and Materials reservoirs for the pathogens and harmful chemical pollutants, leading to the seafood-related diseases [1-3]. All glassware was soaked overnight in 10% (v/v) nitric acid (Merck, Germany), followed by washing with 10% One of the most important issues in the present century (v/v) hydrochloric acid (Merck, Germany) and rinsed with is the discharge of industrial waste water into the rivers double distilled water and dried before using. and seas. Chemical waste waters are usually the sources of heavy metals. Unfortunately, heavy metals can be A Varian Model 220 atomic absorption spectro- accumulated in different organs of fish and marine animals photometer (Varian AA 220FS Atomic Absorption Spectro- and may ultimately affect the human food chain [4-6]. meter System, United States) equipped with a deuterium Consumption of seafoods contain consider levels of heavy background corrector was used for the determination of metals may lead to several disorders. Heavy metals can heavy metals. Lead and cadmium concentrations were easily be accumulate in organs such as the liver and the determined by a graphite furnace atomic absorption kidney in long time periods. Nervous system and kidneys spectrophotometer (GFAAS, Analytik Jena AG, Germany, are the most common targets of lead and cadmium [7,8]. AAS ZEEnit 650) 110 employing pyrolytic platform graphite Cardiovascular collapse, acute paralytic syndrome and loss tubes (Agilent Tech, Santa Clara, California) [13]. Hydride of brain function are the main disorders caused due to the generation was with a Varian model 77 with quartz tubes. consumption of foods containing high levels of arsenic [9]. Long-term ingestion of arsenic increases the risk of skin, All reagents used were of analytical reagent grade bladder, and lung cancers [9]. (Merck, Germany). Standard stock solutions of mercury, arsenic, cadmium and lead were prepared from Titrasol Mercury is an element of special concern because (1000 mg/l) (Merck, Germany) and were diluted to the its inorganic form is biologically transformed in aquatic corresponding metal solution. The working solution environments into methylmercury (MeHg), which is a were freshly prepared by diluting an appropriate aliquot lipophilic organic compound that bioaccumulates and of the stock solutions using 10% HNO3 (Merck, Germany) biomagnifies as it moves up the aquatic food chain [10]. for diluting lead and cadmium solutions, 1 M HCl (Merck, Methylmercury may mimic biologicals and be transported Germany) and 5% H2SO4 (Merck, Germany) for diluting by amino acid or organic anion transporters. Further, the mercury solution, 7 M HCl for diluting arsenic solution generation of reac tive oxidative species is often induced and 5% HCl for diluting tin solution. Stannous chloride, for by metals in their ionic form, resulting in oxidative mercury analysis, was freshly prepared by dissolving 10 g modification of DNA or proteins, including aberrant gene in 100 ml of 6 M HCl. The solution was boiled for about expression and carcinogenesis [11,12]. 5 min, cooled, and nitrogen bubbled through it to expel According to the uncertain status of contamination of any mercury impurities. seafoods of Persian Gulf with dangerous heavy metals, the Sample Preparation and Digestion present study was carried out to evaluate the concentration of lead, cadmium, arsenic and mercury heavy metals in the Each sample was homogenized thoroughly in a fish, shrimp and lobster samples of Persian Gulf. food blender with stainless steel cutters. A sample were then taken and digested promptly as follows: 2 g of the MATERIAL and METHODS homogenized sample was weighed into a 0.5 l glass digestion tube, and for mercury, 10 ml of concentration of Samples Collection HNO3 (Merck, Germany) and 5 ml of concentration of H2SO4 (Merck, Germany) were slowly added. The tube was then During the period of October 2013 to May 2014, a total placed on top of a steam bath unit to complete dissolution. of 200 samples (80 fish, 60 lobster, and 60 shrimp) from the It was then removed from the steam bath, cooled and the supermarkets were randomly collected in the Boushehr solution transferred carefully into a 50 ml volumetric flask; province of the Persian Gulf, Iran. All samples were caught for the reduction of mercury 5 ml SnCl2 (Merck, Germany) 175 RAHIMI, GHEYSARI were used. For arsenic determination 2 g of homogenized aligned in the light path of the hollow cathode lamp sample was weighed after pre-digestion. Then, HNO3 where the absorption was measured. Cadmium and lead mixed with 4 ml of MgNO3 20% (Merck, Germany) as ashing concentrations were determined by graphite furnace aid, dried on a hot plate and ashed in a 450°C furnace. atomic absorption spectrophotometry, employing pyro- The ashes were dissolved in 7 ml of HCl and diluted to 50 lytic platform graphite tubes (Agilent Tech, Santa Clara, ml. For the determination of lead and cadmium, about 2 California), ascorbic acid and palladium for matrix g of homogenized sample were weighed into a 200 ml modification and using the method of additions for beaker and 10 ml of concentration of HNO3 were added. quantification. Graphite Tube Atomizer (GTA) was equipped The beaker was covered with a watch glass and, after most with an auto sampler and the analysis was done according of the sample had dissolved by standing overnight, heated to the manual instruction, optimized conditions and the on a hot plate with boiling until any vigorous reaction method of peak area [13]. had subsided. The solution was allowed to cool in room temperature, transferred into a 50 ml volumetric flask and Statistical Analysis diluted to the mark with distilled water. The results of the mercury, arsenic, cadmium and lead Aquatic samples were spiked with various concentrations concentration in fish, lobster and shrimp were transferred of heavy metals for the recovery repeatability tests and to Microsoft Excel spreadsheet (Microsoft Corp., Redmond, for verifying the analytical methodology. For each run, WA, USA) for analysis. Using SPSS 16.0 statistical software triplicate samples, spiked samples and blanks were carried (SPSS Inc., Chicago, IL, USA), Analysis of Variance (ANOVA) through the digestion reaction. The results are shown in test were used for analysis of the variances. Differences Table 1. were considered significant at values of P<0.05. Chemical Analysis RESULTS Mercury and arsenic were determined by the hydride The results of the present investigation showed that the generation system. The manufacturer operation procedure aquatic food samples of Persian Gulf were contaminated involves continuous addition of reductant, consisting with lead, mercury, cadmium and arsenic heavy metals. of 0.3% NaBH4 (Merck, Germany), 0.5% NaOH (Merck, Concentration of heavy metals in each studied samples Germany) for mercury and 0.6% NaBH4 (Merck, Germany), is shown in Table 2. Heavy metals concentrations in fish 0.5% NaOH, 10% KI for arsenic. The manufacturer’s samples were 91.67±9.21 for lead, 49.00±4.77 for mercury, operating procedure consists of adding sample, reductant 60.37±7.07 for cadmium and 101.33±9.85 μg/g for arsenic. and acid, with the aid of argon gas, to a reaction coil; Lead, mercury, cadmium and arsenic concentration ranges then any vapour generated is swept into the absorption were 64-93, 104-135, 18-34 and 211-265 μg/g in shrimp quartz cell, and heated for arsenic detection. Cells were and 260-390, 71-130, 114-348 and 118-318 μg/g in lobster, respectively. Significant statistically differences were seen Table 1. Evaluation of the recovery rates of lead, cadmium, mercury and arsenic in fish, shrimp and lobster for the concentration of lead between shrimp and lobster Tablo 1. Balık, karides ve ıstakozlarda kurşun, kadmiyum, cıva ve arsenik (P=0.015), concentration of mercury between fish and gerikazanım oranları shrimp (P=0.029), concentration of cadmium between Added Achieved shrimp and lobster (P=0.024) and finally concentration Heavy Concentration Concentration (µg g-1) % Recovery of arsenic between fish and shrimp (P=0.023) and lobster Metals (µg g-1) (Average±SD) and shrimp (P=0.027). Lead 50 47.66±1.15 95.32 Cadmium 50 48.33±2.00 96.66 DISCUSSION Arsenic 50 51.00±1.00 102.00 The results of the present study showed that the fish, Mercury 50 45.33±1.52 90.60 shrimp and lobster samples of Persian Gulf have been Table 2. Average and standard deviation of the concentration of the lead, mercury, cadmium and arsenic heavy metals in fish, shrimp and lobster Tablo 2. Balık, karides ve ıstakozlarda kurşun, cıva, kadmiyum ve arsenik konsantrasyonlarının ortalama ve standart sapmaları Concentration of Heavy Metals (µg g-1) Samples Lead Mercury Cadmium Arsenic Average±SD Range of Average±SD Range of Range of Range of Contamination Contamination Average±SD Contamination Average±SD Contamination Fish 91.67±9.21 63-121 49.00±4.77 19-98 60.37±7.07 18-87 101.33±9.85 62-148 Shrimp 75.67±8.33 64-93 115.67±10.86 104-135 26.00±2.00 18-34 237.67±22.01 211-265 Lobster 316.67±29.58 260-390 98.33±7.74 71-130 131.46±12.57 114-348 105.28±10.21 118-318 176 Evaluation of Lead, Cadmium, ... contaminated with considerable levels of lead, cadmium, in the concentration of heavy metal between various arsenic and mercury heavy metals. However, the levels of races of seafoods have been reported previously [6,22,26,27]. these toxic elements were entirely less than their allowable The season which the seafood samples were collected concentrations but consumption of the contaminated and analyzed for presence of heavy metals is another seafoods even lower than their permissible levels may determinative factor in the concentration of toxic elements. be harmful for human health. One of the most important It seems that different seasonal dependent conditions point to evaluate the levels of lead, cadmium, arsenic and such as water temperature, dietary factors and growth mercury heavy metals in seafood is comparison of the and reproductive cycles are effective on heavy metal permitted extent and acceptance daily intake of heavy fluctuations [28-31]. The higher metal content in winter metals with the amount obtained. The acceptance limits might be a result from considerable rainfall which washed recommended of mercury, lead, cadmium and arsenic is 0.5 down the wastes [28-31]. Therefore, variation in the seasons mg/kg [14-16], 0.5 mg/kg [17], 0.5 mg/kg [14-17] and 6 mg/kg [18], of sampling may has the direct effect of the concentration respectively. The levels of detected lead, cadmium, arsenic of heavy metals. Large differences in the levels of heavy and mercury in our study were 47.66, 48.33, 51.00 and metals in the seafood samples of our study may be 45.33 µg/g, respectively. The levels of detected elements related to the variation in the weight and length of were lower than the acceptable limits recommended. samples. There were no significant differences between the concentrations of heavy metals and average length Average daily lead intake through diet was about and weight of seafood samples (P>0.05). Average length 114 microg/day for adults and 50 microg/day in children and weight of collected samples were 46.9±2.68 cm and and tolerable limit is 250 microg/day for adults and 90 mg/ 642.237±52 g for fish, 18.88±1.67 cm and 45.779±4.51 day for children. Acceptance daily intake of cadmium is 3.0 g for shrimp and 22.3±2.13 cm and 203.098±20 g for µg/kg body weight per day (2-7 µg/kg body weight per day) lobster. Fish samples had the highest length and weight and the tolerable weekly intake of this element 15 µg/kg but had the lowest concentrations of mercury and arsenic. body weight. Tolerable weekly intake of mercury is 1.6 µg/kg Petroody et al.[32] reported the significant relationships body weight. Average daily arsenic intake is 3.0 µg/kg and between lengths and lead concentrations (P<0.01), but its tolerable weekly intake is 15 µg/kg body weight [19-21]. no significance correlation between length and cadmium concentrations were observed. In a study which was Similar studies have been done of the determination of conducted by Jafarzadeh Haghighi et al.[33] concentrations heavy metals such as copper, lead, cadmium, zinc, mercury of cadmium in the fish samples was positively correlated and arsenic in the seafood samples of the Persian with length and weight. Gulf [6,22-24]. Previous study [6] reported that the obtained range of heavy metals in the fish species of Persian Gulf Level of arsenic in the seafood samples in the current were 0.024-0.111 μg/g for cadmium and 0.057-0.471 μg/g study was entirely higher than previous studies that for lead which was entirely lower than our results. Agah reported arsenic concentration in crabs, shrimps, lobster, et al.[22] reported that the concentration range of lead fishes and bivalves of Persian gulf [23,34-36]. In a study which was 0.2-25 ng/g in various species of fish caught from the was conducted by Heidarieh et al.[34] the concentrations Persian Gulf. Reissy et al.[23] showed that the heavy metals of heavy metals was evaluated in crab and shrimp concentrations in lobster samples of Persian Gulf were 32- samples of Persian Gulf, Iran. Their results showed that 73 μg/kg for mercury, 118-275 μg/kg for arsenic, 379-1120 arsenic concentrations in crab and shrimp samples were μg/kg for lead and 101-401 μg/kg for cadmium which was 21.38±3.31 and 8.28±2.82 μg/g, respectively. In another entirely lower than our results except lead concentration. study which was conducted by Javaheri Babooli and In a study which was conducted on Vietnam [24], the lead, Velayatzadeh [37] the mean concentrations of mercury, cadmium, and mercury concentration ranges in shellfish arsenic, cadmium and lead in shrimp samples of Persian were 0.008-0.083, 0.013-0.056, and 0.028-0.056 mg/kg, Gulf was 0.032±0.002, 0.117±0.07, 0.175±0.006, 0.414± respectively. Islam et al.[25] reported that the concentrations 0.012 µg/g which was lower than our results. The main of mercury, arsenic, cadmium and lead varied between anthropogenic sources of arsenic in Persian Gulf are 0.24±0.007 - 0.01±0.001, 44.54±5.69 - 1.23±0.20, 0.13±0.05 emissions from coal burning electrical generating facilities, - ND (not detected), 1.32±0.47 - 0.09±0.02 and 0.74±0.28 - mining and smelting operations, herbicide or algicide 0.05±0.03 mg/kg, respectively. applications especially for algae bloom and leaching from hazardous waste facilities and from insecticide [38]. One possible explanation for the higher presence of heavy metals in our results is the fact that the fish, High concentration of mercury was seen in the seafood shrimp and lobster samples of our study are in close samples of our investigation. Another Iranian survey contact with contaminant sources like oil tankers and showed the mean levels of mercury in  fish samples of industrial wastewaters. Besides, differences in the races Persian Gulf was 0.05 μg/g [39]. Agah et al.[40] reported that of studied seafoods of our investigation with those of total mercury concentrations in fish ranged from 0.0123 to other studies is another reason for the higher prevalence 0.0867 mg/kg. Documented data reported that in several of heavy metals in our research. Considerable differences coastal areas of the Persian Gulf such as United Arab 177 RAHIMI, GHEYSARI Emirates, Iran, Kuwait and Qatar, mercury levels exceeded REFERENCES 0.1 mg/kg in various fish species. Only in the coastal area of Bahrain, the average concentrations of mercury 1. Gogus U, Smith C: N-3 Omega fatty acids: A review of current were below 0.1 mg/kg [41]. Mercury toxic effects have knowledge. Int J Food Sci Technol, 45, 417-436, 2010. DOI: 10.1111/j.1365-2621.2009.02151.x been emphasized by some cases of collective poisoning 2. Kaya Y, Turan H: Comparison of protein, lipid and fatty acids in people who consumed a large amount of fish [42]. It is composition of anchovy (Engraulis encrasicolus L. 1758) during the generally accepted that seafood represents one of the commercial catching season. J Muscle Foods, 21, 474-483, 2010. DOI: major sources of mercury in the human food chain. 10.1111/j.1745-4573.2009.00196.x 3. Miniadis-Meimaroglou S, Dimizas C, Loukas V, Moukas A, Vlachos Other important heavy metals studied in our study A, Thomaidis N, Paraskevopoulou V, Dasenakis M: Proximate composition, were cadmium and lead. Our results showed that the fatty acids, cholesterol, minerals in frozen red porgy. Chem Phys Lipids, 146, 104-110, 2007. DOI: 10.1016/j.chemphyslip.2006.12.009 mean concentration of lead and cadmium in fish, shrimp 4. Has-Schon E, Bogot I, Rajkovic V, Bogut S, Cacic M, Horvatic J: and lobster samples of Persian Gulf had the range of Heavy metal distribution in tissues of six fish species included in human 75.67±8.33 to 316.67±29.58 µg/g and 26.00±2.00 to diet, inhabiting fresh waters of the Nature Park “Hutovo Blato”. Arch 131.46±12.57 µg/g, respectively. In a study which was Environ Contam Toxicol, 54, 75-83, 2008. DOI: 10.1007/s00244-007-9008-2 conducted by Dadolahi and Nazarizadeh Dehkordi [43] on 5. Yildirim Y, Gonulalan Z, Narin I, Soylak M: Evaluation of trace heavy Sediments from the North of the Strait of Hormuz, Persian metal levels of some fish species sold at retail in Kayseri Turkey. Environ Monit Assess, 149, 223-228, 2009. DOI: 10.1007/s10661-008-0196-7 Gulf, Iran the mean concentrations of lead and cadmium 6. Saei-Dehkordi S, Fallah AA: Determination of copper, lead, cadmium were 3.00 to 28.00 and 2.96 to 10.11 mg/g, respectively and zinc content in commercially valuable fish species from the Persian which was entirely lower than our findings. Haghighi et Gulf using derivative potentiometric stripping analysis. Microchem J, 98, al.[33] reported the lower range of cadmium in two different 156-162, 2011. DOI: 10.1016/j.microc.2011.01.001 fish samples of Persian Gulf (0.1±.05 to 0.31±0.09 mg/g). 7. Özden Ö, Ulusoy Ş, Erkan N: Study on the behavior of the trace metal The concentrations of cadmium and lead in the fish and macro minerals in Mytilus galloprovincialis as a bioindicator species: The case of Marmara Sea, Turkey. J Verbr Lebensm, 5, 407-412, 2010. DOI: samples of Persian Gulf have been studied previously by 10.1007/s00003-009-0544-8 Mohammadnabizadeh et al.[44]. They showed that the total 8. Garcia-Rico L, Leyva-Perez J, Jara-Marini ME: Content and daily concentration of cadmium and lead in the fish samples intake of copper, zinc, lead, cadmium, and mercury from dietary had the ranges of 0.58±0.03 to 1.7±0.2 and 0.22±0.06 to supplements in Mexico. Food Chem Toxicol, 45, 1599-1605, 2007. DOI: 1.12±0.17 mg/g, respectively. 10.1016/j.fct.2007.02.027 9. Curtis DE: Other Trace Elements: Sources, Modern Nutrition in The main factors which may lead to the pollution Health and Disease. 10 th ed., 338-350, Lippincott Williams and Wilkins, Philadelphia, 2006. of water sources with heavy metals mainly are leakage 10. Narvaes DM: Human Exposure to Mercury in Fish in Mining Areas of industrial sewage from seaside, industrial effluents, in the Philippines. FAO/WHO Global Forum of Food Safety Regulation. agricultural runoff, domestic and municipal sewage and Morocco: Marrakec. 2002. pedogenic background contributions. 11. ASTDR: Toxicological Profile for Mercury. www.atsdr.cdc.gov/ ToxProfiles/tp.asp?id=115&tid=24, Accessed: November 30, 2010. In conclusion, the results of the present study indicated 12. Clarkson TW, Magos L, Myers GJ: The toxicology of mercury - Current that the seafoods of the Persian Gulf were contaminated exposures and clinical manifestations. N Engl J Med, 349, 1731-1737, 2003. with low range of lead, cadmium, arsenic and mercury DOI: 10.1056/NEJMra022471 heavy metals. Our results indicated the improvement of 13. Moreiras O, Cuadrado C: Theoretical study of the intake of trace local environmental conditions with respect to mercury, elements (nutrients and contaminants) via total diet in some geographical areas of Spain. Biol Trace Element Res, 32, 93-103, 1992. DOI: 10.1007/ lead, arsenic and cadmium concentrations, which is BF02784592 explained by reduced industrial activity in the region 14. EU: Commission regulation as regards heavy metals. Amending (Boushehr seaside), the use of more efficient dust traps and Regulation, 466/2001, No. 78/2005. filters in recent years, and, hence, the decreased discharge 15. FAO: Compilation of legal limits for hazardous substances in fish and of these metals into the sea. However, the contents of fishery products. In, FAO Fishery Circular, Inland Water Resources and toxic metals in Persian Gulf were below the permitted Aquaculture Service. No. 464. Rome, 5-100, 1983. levels but more studies are needed to properly assess 16. Mergler D, Anderson HA, Chan LHM, Mahaffey KR, Murray M, Sakamoto M, Stern H: Methylmercury exposure and health other sources and even other sites of the Persian Gulf to effects in humans: A worldwide concern. Ambio, 36, 3-11, 2007. DOI: monitoring the levels of heavy metals. 10.1579/0044-7447(2007)36[3:MEAHEI]2.0.CO;2 17. FAO/WHO: Evaluation of certain food additives and the contaminants Acknowledgements mercury, cadmium and lead. WHO Technical Report Series. No. 505. Geneva: WHO. Geneva, Switzerland, 1972. The authors would like to thank Prof. Afshin 18. Choi YY: International/National Standards for Heavy Metals in Food. Government Laboratory, 2011. Akhondzadeh Basti, Prof. Vadoud Razavilar, and Dr. Farhad 19. WHO: Safety evaluation of certain food contaminants. Geneva, Safarpoor Dehkordi at the Department of Food Hygiene World Health Organization (WHO Food Additives Series, No. 63, 2011. and Quality Control, University of Tehran and Infectious 20. JECFA: Methylmercury. In, Safety Evaluation of Certain Food Diseases for their important technical support. Additives and Contaminants. Report of the 61st Joint FAO/WHO Expert 178 Evaluation of Lead, Cadmium, ... Committee on Food Additives. Geneva, World Health Organization, and Ni in the soft tissue of rock oyster Saccostrea cucullata from Laft Port. International Programme on Chemical Safety. WHO Technical Report J Persian Gulf, 4 (14): 39-45, 2013. Series, 922, 132-139, 2004. 33. Jaafarzadeh Haghighi N, Khoshnood R, Khoshnood Z: Cadmium 21. FDA: Fish and fishers products hazards and controls guidance. In, determination in two flat fishes from two fishery regions in north of the U.S. Food and Drug Administration Center for Food Safety and Applied Persian Gulf. Iran J Fish Sci, 10 (3): 537-540, 2011. Nutrition, Chapter 9: Environmental Chemical Contaminants and 34. Heidarieh M, Ghannadi Maragheh M, Azizi Shamami M, Behgar Pesticides. 4th ed., New Hampshire, USA. 155-180, 2011. M, Ziaei F, Akbari Z: Evaluate of heavy metal concentration in shrimp 22. Agah H, Leermakers M, Elskens M, Fatemi SMR, Baeyens W: (Penaeus semisulcatus) and crab (Portunus pelagicus) with INAA method. Accumulation of trace metals in the muscle and liver tissues of five fish Springer Plus, 2, 1-5, 2013. DOI: 10.1186/2193-1801-2-72 species from the Persian Gulf. Environ Monit Assess, 157, 499-514, 2009. 35. Al-Mohanna SY, Subrahmanyam MNV: Flux of heavy metal DOI: 10.1007/s10661-008-0551-8 accumulation in various organs of the intertidal marine blue crab, 23. Raissy M, Ansari M, Rahimi E: Mercury, arsenic, cadmium and lead Portunus pelagicus (L.) from the Kuwait coast after the Gulf War. Environ in lobster (Panulirus homarus) from the Persian Gulf. Toxicol Ind Health,  Int, 27, 321-326, 2001. DOI: 10.1016/S0160-4120(01)00063-0  27, 655-659, 2011. DOI: 10.1177/0748233710395346 36. De Mora S, Fowler SW, Wyse E, Azemard S: Distribution of 24. Nguyen TA,  Roudot AC,  Massin DP: Risk assessment of heavy heavy metals in marine bivalves, fish and coastal sediments in the Gulf metals in shellfish for the population in Nha Trang City, Vietnam. J Environ and Gulf of Oman. Mar Pollut Bull, 49, 410-424, 2004. DOI: 10.1016/j. Health, 76 (6): 56-64, 2014. marpolbul.2004.02.029 25. Islam MM, Bang S, Kim K, Ahmed MK, Jannat M: Heavy metals in 37. Javaheri Baboli M, Velayatzadeh M: Determination of heavy metals frozen and canned marine fish of Korea. J Sci Res, 2, 549-557, 2010. DOI: and trace elements in the muscles of marine shrimp, fenneropenaeus 10.3329/jsr.v2i3.4667 merguiensis from Persian Gulf, Iran. J Anim Plant Sci, 23 (3): 786-791, 2013. 26. Pourang N, Nikouyan A, Dennis JH: Trace element concentrations 38. Anonymous: Mercury, Lead, Cadmium, Tin and Arsenic in Food. in fish, superficial sediments and water from northern part of the Persian Toxicol Fact Sheet Series 1, 1-13, 2009. Gulf. Environ Monit Assess, 109, 293-316, 2005. DOI: 10.1007/s10661-005- 39. Abdolvand S,  Kayedinejad Esfahani S,  Dmirchi S: Mercury (Hg) 6287-9 and methyl mercury (MMHg) bioaccumulation in three fish species 27. Kerdthep P, Tongyonk L, Rojanapantip L: Concentrations of (sea food) from Persian Gulf. Toxicol Environmental Health Sci, 6, 192-198, cadmiumand arsenic in seafood from Muang District, Rayong province. 2014. DOI: 10.1007/s13530-014-0204-y J Health Res, 23 (4): 179-184, 2009. 40. Agah H, Leermakers M, Elskens M, Fatemi SMR, Baeyens W: Total 28. Saei-Dehkordi SS, Fallah AA, Nematollahi A: Arsenic and mercury mercury and methyl mercury concentrations in fish from the Persian Gulf in commercially valuable fish species from the Persian Gulf: Influence and the Caspian Sea. Water Air Soil Pollut, 181, 95-105, 2007. DOI: 10.1007/ of season and habitat. Food Chem Toxicol, 48, 2945-2950, 2010. DOI: s11270-006-9281-0 10.1016/j.fct.2010.07.031 41. Madany IM, Wahab AAA, Alalawi Z: Trace metal concentrations in 29. Ersoy B, Çelik M: Essential elements and contaminants in tissues of marine organisms from the coastal areas of Bahrain, Arabian Gulf. Water commercial pelagic fish from the Eastern Mediterranean Sea. J Sci Food Air Soil Pollut, 91, 233-248, 1996. DOI: 10.1007/BF00666260 Agric, 89, 1615-1621, 2009. DOI: 10.1002/jsfa.3646 42. Chen L, Yang F, Zhang Y, Hu Q, Pan G:  Selenium analysis of some 30. Meche A, Martins MC, Lofrano BESN, Hardaway CJ, Merchant polished rice in China and effect of biological selenium-enriched fertilizers M, Verdade L: Determination of heavy metals by inductively coupled on level and chemical constitution of selenium in rice grains.  Chinese J plasma-optic emission spectrometry in fish from Piracicaba River in Rice Sci, 16 (4): 341-345, 2002. Southern Brazil. Microchem J, 94, 171-174, 2010. DOI: 10.1016/j.microc. 43. Dadolahi S, Nazarizadeh Dehkordi A: Heavy metals contamination 2009.10.018 in sediments from the North of the Strait of Hormuz. J Persian Gulf, 4 31. Dural M, Göksu MZL, Özak AA: Investigation of heavy metal levels (11): 39-46, 2011. in economically important fish species captured from the Tuzla lagoon. 44. Mohammadnabizadeh S, Pourkhabbaz A, Afshari R: Analysis Food Chem, 102, 415-421, 2007. DOI: 10.1016/j.foodchem.2006.03.001 and determination of trace metals (nickel, cadmium, chromium, and 32. Petroody A, Hamidian SS, Ashrafi AH, Eagderi S, Khazaee S: lead) in tissues of Pampus argenteus and Platycephalus indicus in the Hara Investigation of body size effect on bioaccumulation pattern of Cd, Pb Reserve, Iran. J Toxicol, 2014, 1-6, 2014. DOI: 10.1155/2014/576496 Kafkas Univ Vet Fak Derg KafKas Universitesi veteriner faKUltesi Dergisi 22 (2): 179-183, 2016 JoUrnal Home-Page: http://vetdergi.kafkas.edu.tr Research Article DOI: 10.9775/kvfd.2015.14027 online sUbmission: http://vetdergikafkas.org Determination of Potential Biomarker among Plasma Sphingosine-1-Phosphate, Total Sialic Acid and Adenosine Deaminase in Cattle with Naturally Infected Liver Cystic Echinococcosis Azad VAKILI 1 Kaveh AZIMZADEH 2 Sohrab RASOULI 3 1 Graduate of Veterinary Medicine, Urmia Branch, Islamic Azad University, Urmia, IRAN 2 Department of Clinical Sciences, Veterinary Faculty, Urmia Branch, Islamic Azad University, Urmia, IRAN 3 Department of Pathobiology, Veterinary Faculty, Urmia Branch, Islamic Azad University, Urmia, IRAN Article Code: KVFD-2015-14027 Received: 09.07.2015 Accepted: 15.01.2016 Published Online: 19.01.2016 Abstract The purpose of this trial was to assay the alterations of some blood parameters such as sphingosine 1 phosphate (S1P), total sialic acid (TSA) and adenosine deaminase (ADA) and clarification of possible potential biomarker among them in naturally infected liver cystic echinococcosis in cattle. After observation of severe liver parasitic infestation (as cystic form) and blood sampling from parasitized and healthy ones, all selected biochemical analytes were clarified and results determined significant increase (P≤0.01) of aforementioned parameters in parasitized group rather than healthy ones. In conclusion, based on high sensitivity of TSA and ADA than S1P, they could be considered as potential biomarker in CE. Keywords: Biochemical parameters, Cattle, Echinococcosis Doğal Enfekte Karaciğer Kistik Ekinokokozisli Sığırlarda Plazma Sfingosin-1-fosfat, Total Sialik asit ve Adenozindeaminaz Arasından Potansiyel Biomarkerın Belirlenmesi Özet Bu çalışmanın amacı, doğal enfekte karaciğer kistik ekinokokozisli sığırlarda sfingozin-1-fosfat (S1P), total siyalik asit (TSA) ve adenozin deaminaz (ADA) için kan değerlerinin belirlenmesi ve böylece aralarından hangisinin muhtemel potansiyel bir biyomarker olabileceğinin belirlenmesidir. Parazitli olan (şiddetli kistik formu) ve sağlıklı sığırlardan kan örnekleri alındıktan sonra, belirtilen tüm biyokimyasal analizler yapıldı ve sonuçlar karşılaştırıldığında parazitli olan grupta anlamlı bir artış (P≤0.01) olduğu belirlendi. Sonuç olarak, TSA ve ADA S1P`e göre daha yüksek hassasiyetlik göstermesi sebebiyle, kistik ekinokokkozisde potansiyel biyomarker olarak değerlendirilebilir. Anahtar sözcükler: Biyokimyasal parametreler, Sığır, Ekinokokozis INTRODUCTION inspection of carcass at the slautherhouse can lead to detection of disease [2,3]. Echinococcus granulosus contributes in the occurrence of cystic echinococcosis (CE) in animals (domestic and Sphingosine 1-phosphate (S1P) is known as novel wild herbivores) and man. Echinococcosis is known as one bioactive lipid mediator which belongs to sphingolipids of the most essential zoonotic diseases in the world and group and it participates in both cellular physiological possesses important effect on human and animal health and pathophysiological pathways [4]. Subsequent studies with remarkable economic detriments [1]. Carnivores determined that S1P is abundantly existed in plasma and play substantial effect as definitive hosts, while domestic other body fluids, where it acts as autocrine or paracrine ungulates and human are involved as the intermediate effects onto fundamental cell functions [5]. Erythrocytes hosts. Similarly, sheep participate in disease transmission and platelets store and liberate S1P into blood and they are and the strain (G1) of Echinococcus granulosus causes CE. considered as fundamental sources of S1P [6]. In addition, It is usually asymptomatic in livestock, however, during S1P involve as major bioactive molecule in exhausting  İletişim (Correspondence)  +98 443 2759180  kn_az@yahoo.com 180 Determination of Potential ... of lymphocyte from the secondary lymphoid tissues into in the immersion objective (X100) revealed no parasite in the lymph. Thus, these findings forcefully suggest that infected and healthy sheep. S1P has fundamental effects in vivo as well as potentially pathophysiological roles as a circulating paracrine All samples were centrifuged 6.000 g for 10 min at mediator [5]. It should be noted that ability of S1P in the room temperature for plasma and serum preparation and modulation of fibroblasts migration has been determined were kept frozen (−25°C) until the analysis. The plasma and plays substantial role in fibrosis in different tissues [7]. S1P level was determined using a RA1000 in accordance with the ELISA method by (East Biopharm Co, Hangzhou, Sialic acid (SA) is acetylated derivative of neuraminic China). TSA was measured by Sydow method [15] in serum acid which has been broadly distributed in mammal tissues (spectrophotometer, model Spekol 1500, Germany). Total and body fluids. SA is classified in three forms namely bilirubin and unconjugated bilirubin were measured protein-bounded sialic acid (PBSA), lipid-bounded sialic colorimetrically by (Pars Azmoon Co. kits Tehran, Iran) in acid (LBSA) and free form and it is involved at the end chain serum. Finally, ADA activity was determined by the electro- of many acute phase proteins [8]. Thus, the detection of SA chemiluminescence method (Roche Co. Elecsys 2010). might be a momentous marker for diagnosis and prognosis of inflammatory diseases [8,9]. In many infectious diseases, Statistical analysis was accomplished in all analyses. The SA are determined in cattle, such as keratoconjunctivitis, Mean ± SD and the determination of variation between the leptospirosis, pneumonia, theileriosis, anaplasmosis and data results were carried out with Student’s t-test through traumatic reticulo-peritonitis [8]. It is linked to residues of SAS v9.1 (SAS Institute Inc., Cary, NC, USA). The significance the carbohydrate chains of glycoproteins and glycolipids level was specified at (P<0.01). Moreover, determination of (especially non-reducing sections) [10]. This linkage becomes cut-off point among with ROC analysis were carried out it susceptible to get involved in cellular and molecular in all parameters for sensitivity and specificity detection. interrelationships and also participates in lipoproteins and lipid metabolism [11]. RESULTS Adenosine deaminase (ADA) is involved in degradation All of the altered parameters are shown in Table 1. of adenosine and deoxyadenosine into inosine and de- Significant increase (P<0.01) in S1P, TSA, ADA, total bilirubin oxyinosine. ADA, as an essential enzyme, contributes to and unconjugated bilirubin levels were revealed in the the maturation and differentiation of T lymphocytes and patient group compared to the healthy ones. In the its activity is higher in T cells than B cells [12]. The ADA respect of Table 2, based on cut-off point, AUC and ROC regulates the cellular mechanisms associated with blood curve statistical analysis, all parameters possesses different flow, vasodilatation, angiogenesis and proliferation [13]. It sensitivity and specificity percentage and among them has been indicated that serum ADA activity is higher in TSA and ADA sensitivity are better than S1P sensitivity. In diseases associated with immune response stimulation the Fig. 1, significant increase of TSA (42.84 mg/dl) in the such as liver cirrhosis, chronic hepatitis and hepatocellular patient group has been noted compared with control ones carcinoma. Generally, serum ADA level has been referred (14.07 mg/dl). The Fig. 2 illustrate ADA alterations between in human and animals as an important indicator for two groups. Considerable elevation (42.17 U/L) in patient detection of liver diseases [14]. group versus (15.92 U/L) in control ones. Regarding S1P as bioactive mediator (Fig. 3), considerable increase To our knowledge, no research has been conducted (271.77ng/L) was demonstrated compared control group to determine potential biomarker among TSA, ADA and (89.33 ng/L). In connection with bilirubin metabolism (Fig. 4), S1P in cattle echinococcosis. Thus, the present study total and unconjugated form have been severely increased aimed to investigate the above-mentioned issue in cattle echinococcosis. Table 1. Alterations of plasma S1P, ADA and TSA levels in the control and patient groups MATERIAL and METHODS Tablo 1. Kontrol ve hasta gruplarında plasmadaki S1P, ADA ve TSA seviyelerindeki değişiklikler This study was conducted in Urmia city (West Azerbaijan Parameters Control Group Patient Group province), Iran. Ten milliliters of blood were collected via TSA (mg/dl) 14.07±2.85 42.84±8.56† the jugular vein of cattle (20-22 months) that had been † admitted for slaughtering at the abattoir of Urmia and ADA (U/L) 15.92±3.15 42.17±10.02 blood samples transferred equally to EDTA-contained and S1P (ng/l) 89.33±20.48 271.77±82.57† non-EDTA contained tubes. After slaughtering, animals Total bilirubin (mg/dl) 0.34±0.012 1.49±0.02† were surveyed based on observation of severe hepatic CE † in liver. Eighty animals were infected to hepatic CE and Unconjugated bilirubin (mg/dl) 0.07±0.001 0.82±0.06 same number were also selected as control group (healthy Data are expressed as mean ± standard deviation. † Significantly different animals). Microscopic examination of blood smears staining from the control group (P<0.01) 181 VAKILI, AZIMZADEH RASOULI Table 2. According to table, as area under the curve for each parameter is equal to 1. Hence all parameters have good specificity, but TSA and ADA sensitivity are higher than S1P Tablo 2. Tablo ya göre, her bir parametre için eğrinin altında kalan alan olarak 1’e eşittir. Dolayısıyla tüm parametrelerin iyi özgüllüğü vardır, fakat TSA ve ADA hassasiyeti S1P göre daha yüksektir Parameter Cut-off Point AUC P Value Sensitivity (%) Specificity (%) S1P 55/180 1 0001/0 5/87-85 100 TSA 69/28 1 0001/0 100- 5/97 100 ADA 81/28 1 0001/0 95 100 Fig 1. Alterations of TSA levels in infected group compared with control Fig 3. Alterations of S1P levels in infected group compared with control ones ones Şekil 1. Kontrol grubuyla karşılaştırıldığında enfekte grupta TSA düzey- Şekil 3. Kontrol grubuyla karşılaştırıldığında enfekte grupta S1P lerindeki değişimler düzeylerindeki değişimler Fig 2. Alterations of ADA levels in infected group compared with Fig 4. Alterations of total bilirubin and unconjugated bilirubin levels in control ones infected group compared with control ones Şekil 2. Kontrol grubuyla karşılaştırıldığında enfekte grupta ADA Şekil 4. Kontrol grubuyla karşılaştırıldığında enfekte grupta total düzeylerindeki değişimler bilirubin and konjuge olmayan bilirubin düzeylerindeki değişimler 182 Determination of Potential ... Fig 5. ROC Curve for three parameters Şekil 5. Üç parametre için ROC eğrisi in patient group (1.49 and 0.82 mg/dl) rather than healthy activation and stimulation, subsequently, S1P synthesis is group (0.34 and 0.07 mg/dl) respectively. Fig. 5, illustrates reduced [20,21] which is not in accordance with our evidence. ROC (Receiver Operating Characteristic) among three One of the reasons of S1P increase may be attributed parameters along with AUC (Area under Curve) for to high concentration of HDL. The HDL is known to be determination of sensitivity and specificity. the major bio-molecule which possesses S1P. The HDL participates in remove of some blood parasites and may DISCUSSION play a substantial role in the increase of S1P in CE. The significant increase of S1P revealed in this study. We could Sialic acid, plasma proteins, glycoproteins and lipids not find any evidence which related to S1P alterations in hepatic CE. Li et al.[22]are mostly synthesized in the liver [11] and sialic acid is showed that S1P concentration to be linked to non-reducing residues of the carbohydrate chains increased in CCL4-mediated hepatic fibrosis in rat which is [23] of glycoproteins and glycolipids [16]. High levels of TSA in accordance with our study. Ikeda et al. showed S1P were determined in echinococcosis group compared with reduction in liver fibrosis patients that is not consistent the healthy ones. We could not clarify any information with our evidence. Platelets are known to be one of about sialic acid alterations in cattle CE. Stefenelli et al.[17] the main sources of S1P in plasma during sphingosine [24,25] reported a significant decrease of TSA in chronic liver phosphorylation by sphingosine kinase . In line with diseases such as cirrhosis than control ones. Yurtseven this, platelets are recognized to reserve S1P plentifully and et al.[10] revealed low concentration of TSA in cattle with after activation, release it into the plasma [26]. In the respect [26] theileriosis. Chrostek et al.[11] demonstrated decrease of platelets, Togill et al. suggested arising of platelets of lipid-bound sialic acid in non-alcoholic cirrhosis and activation followed by chronic hepatic diseases. Moreover, attributed it to liver diseases that impressed serum level CE is generally associated with long time hepatic damage of lipids and lipoproteins and also the level of sialic in cattle. Consequently, platelets might be activated in acid bounded with these compounds which are not in cattle with liver CE which could cause S1P elevation. accordance with our study. It worth mentioning that Furthermore, it is possible that plasma S1P may be raised many studies have revealed significant increase of sialic due to unknown source(s) which need further clarified. acid in various diseases such as cancer, inflammatory The ADA activity was significantly raised in the hepatic CE disorders, cardiovascular diseases and diabetes mellitus group than healthy ones. Isik et al. [27] showed low levels and even sialic acid has been demonstrated as one of the of ADA activity in surgically treated hydatid patients and inflammatory markers [9]. Since, sialic acid is considered to ascribed it to amelioration of damaged tissue or cease be inflammatory marker. It is likely, significant increase in of lymphocyte proliferation during parasite elimination. plasma TSA in cattle with hepatic CE can be attributed to Moreover, in another study, the ADA activity decrease disease-mediated TSA synthesis and production followed during experimental infection of mice with a secondary by infection in liver. hydatid disease was attributed to immunosuppression associated with the disease [28] that are not consistent The substantial effects of S1P has been determined on with our finding. Umaramani et al.[29] reported significant the function of T and B lymphocytes which is included in increase of ADA activity followed by viral hepatitis which the maturation and migration of them. It plays especially is in accordance with our study. This may have been the as an substantial effect onto activation of T cell [18,19]. It has case in our study as liver echinococcosis causes cellular- been demonstrated that during the T and B lymphocytes immunity stimulation related to ADA activity increase. 183 VAKILI, AZIMZADEH RASOULI In conclusion, on the basis of our findings, the results Rev Méd Vét, 161, 479-484, 2010. denote increase of all plasma parameters. Moreover, due 14. Atakisi E, Karapehlivan M, Atakisi O, Kontas T, Marasli S: Adenosine to high sensitivity of TSA and ADA than S1P, they could deaminase and biochemical liver function tests in the dermatophytic cattle. Bull Vet Inst Pulawy, 50, 481-483, 2006. be utilized as potential biomarker in cattle CE. 15. Sydow G: A simplified quick method for determination of sialic acid in serum. Biomed Biochim Acta, 44, 1721-1723, 1985. REFERENCES 16. Pönniö M, Alho H, Nikkari ST, Olsson U, Rydberg U, Sillanaukee P: Serum sialic acid in a random sample of the general population. Clin 1. Ergin S, Saribas S, Yuksel P, Zengin K, Midilli K, Adas G, Arikan S, Chem, 45, 1842-1849, 1999. Aslan M, Uysal H, Caliskan R, Oner A, Kucukbasmaci O, Kaygusuz 17. Stefenelli N, Klotz H, Engel A, Bauer P: Serum sialic acid in malignant A, Mamal Torun M, Kocazeybek B: Genotypic characterisation of tumors, bacterial infections and chronic liver diseases. J Cancer Res Echinococcus granulosus isolated from human in Turkey. Afr J Microbiol Clin Oncol, 109, 55-59, 1985. DOI: 10.1007/BF01884255 Res, 4, 551-555, 2010. 18. Goetzl EJ, Rosen H: Regulation of immunity by lyso sphingolipids 2. Latif AA, Tanveer A, Maqbool A, Siddiqi N, Kyaw-Tanner M, Traub RJ: and their G-protein-coupled receptors. J Clin Invest, 114, 1531-1537, Morphological and molecular characterisation of Echinococcus granulosus 2004. DOI: 10.1172/JCI200423704 in livestock and humans in Punjab, Pakistan. Vet Parasitol, 170, 44-49, 2010. DOI: 10.1016/j.vetpar.2010.02.003 19. Hait NC, Oskeritzian CA, Paugh SW, Speiegel S: Sphingosine kinase, sphingosine 1-phosphate, apoptosis and disease. Biochim Biophs 3. Pednekar RP, Gatne ML, Thompson RCA, Traub RJ: Molecular and Acta, 1758, 2016-2026, 2006. DOI: 10.1016/j.bbamem.2006.08.007 morphological characterisation of Echinococcus from food producing animals in India. Vet Parasitol, 165, 58-65, 2009. DOI: 10.1016/j.vetpar. 20. Graeler M, Goetzl EJ: Activation - regulated expression and chemotactic 2009.06.021 function of sphingosine 1- phosphate receptors in mouse splenic T cells. FASEB J, 16, 1874-1878, 2002. DOI: 10.1096/fj.02-0548com 4. Kowalski GM, Carey AL, Selathurai A, Kingwell BA, Bruce CR: Plasma sphingosine-1-phosphate is elevated in obesity. PLoS ONE, 8, e72449, 21. Zheng Y, Kong Y, Goetzl EJ: Lysophosphatidic acid receptor selective 2013. DOI: 10.1371/journal.pone.0072449 effects on jurkat T cell migration through a matrigel model basement membrane. J Immunol, 166, 2317-2322, 2001. DOI: 10.4049/ jimmunol. 5. NoferJ-R, MD, MBA: High density lipoprotein, sphingosine 1phosphate, 166.4.2317 and Atherosclerosis. J Clin Lipidology. 33, 48129, 2008. DOI: 10.1016/j. jacl.2007.11.002 22. Li C, Jiang X, Yang L, Liu X, Yue S, Li L: Involvement of sphingosine 1-phosphate (SIP)/S1P3 signaling in cholestasis-induced liver fibrosis. 6. Hanel P, Andreani P, Graler MH: Erythrocytes store and release Am J Pathol, 175, 1464-1472, 2009. DOI: 10.2353/ajpath.2009.090037 sphingosine 1-phosphate in blood. FASEB J. 21, 1202-1209, 2007. DOI: 10.1096/fj.06-7433com 23. Ikeda H, Ohkawa R, Watanabe N, Nakamura K, Kume Y, Nakagawa H, Yoshida H, Okubo S, Yokota H, Tomiya T, Inoue Y, Nishikawa T, 7. Takuwa Y, Ikeda H, Okamoto Y, Takuwa N, Yoshioka K: Sphingosine- Ohtomo N, Tanoue Y, Koike K, Yatomi Y: Plasma concentration of 1-phosphate as a mediator involved in development of fibrotic diseases. bioactive lipid mediator sphingosine 1-phosphate is reduced in patients Biochim Biophys Acta, 1831, 185-192, 2013. DOI: 10.1016/j.bbalip. with chronic hepatitis C. Clin Chim Acta, 411, 765-770, 2010. DOI: 2012.06.008 10.1016/j.cca.2010.02.063 8. Guzel M, Askar TK, Kaya G, Atakisi E, Erbil Avci G: Serum sialic acids, 24. Pappu R, Schwab SR, Cornelissen I: Promotion of lymphocyte egress total antioxidant capacity, and adenosine deaminase activity in cattle into blood and lymph by distinct sources of sphingosine-1-phosphate. with therliriosis and anaplasmosis. Bull Vet Inst Pulawy, 52, 227-230, 2008. Science, 316, 295-298, 2007. DOI: 10.1126/science.1139221 9. Citil M, Gunes V, Karapehlivan M, Atalan G, Marasli S: Evaluation 25. Yatomi Y, Ruan F, Hakomori S, Igarashi Y: Sphingosine-1-phosphate: of serum sialic acid as an inflammation marker in cattle with traumatic A platelet activating sphingolipid released from agonist-stimulated reticulo peritonitis. Rev Med Vet, 155, 389-392, 2004. human platelets. Blood, 86, 193-202, 1995. 10. Yurtsevan S, Uysal H: Decreased serum sialic acid, albumin-globulin 26. Toghill PJ, Green S: Platelet dynamics in chronic liver disease using ratio and total protein levels in cattle heavily infected with Theileria the 111Indium oxine label. Gut, 24, 49-52, 1983. annulata. Ankara Üniv Vet Fak Derg, 56, 141-144, 2009. 27. Isik S, Karaman U, Raika Kiran T, Özer A: Serum Adenosine 11. Chrostek L, Cylwik B, Panasiuk A, Brodowska-Adamusiak D, deaminase (ADA) levels in surgically treated hydatid cyst patients. Sci Res Gruszewska E: Lipid-bound sialic acid (LSA) in liver diseases of different Essays, 6, 3101-3102, 2011. etiologies. Annal Hepatology J, 10, 150-154, 2011. 28. Juma ASM, Al-Jeboori TI, Shubber EK: Adenosine deaminase 12. Gopi A, Madhavan SM, Sharma SK, Sahn SA: Diagnosis and activity of erythrocytes from mice experimentally infected with secondary treatment of tuberculosis pleural effusion in 2006. Chest, 131, 880-889, hydatid disease. Dirasat Med Biol Sci, 2, 110-116, 2000. 2007. DOI: 10.1378/chest.06-2063 29. Umaramani G, Sameera K, Suryanarayana D: Evaluation of serum 13. Aydin I, Bulbul T, Polat ES, Yazar E: Serum antioxidant status and adenosine deaminase activity in viral hepatitis. Int J Biol Med Res. 3 (3): adenosine deaminase activity during the gestational period of sheep. 2017-2019, 2012. Kafkas Univ Vet Fak Derg KafKas Universitesi veteriner faKUltesi Dergisi 22 (2): 185-190, 2016 JoUrnal Home-Page: http://vetdergi.kafkas.edu.tr Research Article DOI: 10.9775/kvfd.2015.14051 online sUbmission: http://vetdergikafkas.org Semen Characteristics and Cardiac Enzymes in Healthy Male Cats Fed with Commercial Cat Food Containing Yucca schidigera [1] [2] Handan AYDIN VURAL 1 Alper BARAN 2 Huriye BALCI 3 [1] This study was supported by “Research Fund of Istanbul University with the grant number UDP-53547” [2] This study was presented as an poster presentation in Global Veterinary Summit, August 31-September 2, 2015, Orlando-USA 1 Istanbul University, Faculty of Veterinary Medicine, Department of Toxicology and Pharmacology, TR-34320 Avcilar, Istanbul - TURKEY 2 Istanbul University, Faculty of Veterinary Medicine, Department of Reproduction and Artificial Insemination, TR-34320 Avcilar, Istanbul - TURKEY 3 Istanbul University, Cerrahpasa Medical Faculty, Fikret Biyal Central Research Laboratory, TR-34303 Cerrahpasa, Istanbul - TURKEY KVFD-2015-14051 Received: 14.07.2015 Accepted: 20.11.2015 Published Online: 24.11.2015 Abstract This study has been designed to examine the effect on cardiovascular enzymes, testosterone and semen characteristics of the Yucca schidigera extract (YSE), used as a feed additive in commercial cat food for the purpose of decreasing faecal odour in male cats. In eighteen healthy male cats, while the biomarker cardiac troponin I (cTnI), known as the “gold standard” for cardiovascular assessment in cats was used, creatin kinase-MB (CK-MB), total cholesterol and triglyceride levels were also investigated as aiding parameters. The level of cTnI was 0.16±0.03 ng/ml before feeding without YSE. It was found 0.20±0.04 ng/ml after feeding with YSE. Similarly, results of the study demonstrated that there was no difference statistically in cardiovascular or lipidic parameters after feeding on this type of cat food for 12 weeks. The level of testosterone was 0.29±0.01 ng/ml before feeding without YSE. It was found 0.21±0.02 ng/ml after feeding with YSE. (P>0.05). Therefore, semen analysis revealed a statistically significant increase in sperm motility alongside a significant decrease in sperm abnormalities. The mean volume, concentration, motility and total sperm defect rates were 118.61±8.55 µl, 197.78±12.83x106/ml, 83.33±1.06% and 27.22±1.33% before feeding without YSE, respectively. These values were 213.06±21.29 µL, 300.56±16.59x106/ml, 90.00±1.07% and 18.67±0.59% after feeding with YSE, respectively. The differences between these values were statistically significant (P<0.001). It was concluded at the end of the study that the commercial cat food containing Yucca schidigera extract could be beneficial effects of the sperm volume, concentration, motility and total morphological defect rates in healthy male cats. Keywords: Male cat, Yucca schidigera, Semen, Cardiac enzymes Yucca schidigera İçeren Ticari Kedi Mamaları ile Beslenen Sağlıklı Erkek Kedilerde Sperma Özellikleri ve Kardiyak Enzim Analizleri Özet Bu çalışma, erkek kedilerde fekal kokuyu azaltmak amacıyla ticari kedi mamalarına bir yem katkı maddesi olarak kullanılan Yucca schidigera ekstraktının (YSE) kardiyovasküler enzimler, testosteron ve spermatolojik özellikler üzerindeki etkisini incelemek için dizayn edilmiştir. Onsekiz adet sağlıklı erkek kedide, kedilerde kardiyovasküler değerlendirme için “altın standart” olarak bilinen biyobelirtec kardiyak troponin I (cTnI), kreatin kinaz-MB (CK-MB), total kolesterol ve trigliserid düzeyleri incelendi. cTnI düzeyi YSE içermeyen beslenmeden önce 0.16±0.03 ng/ml bulundu. Bu değer YSE ilavesi ile beslendikten sonra 0.20±0.04 ng/ml olarak tespit edildi. Benzer şekilde, 12 hafta boyunca beslenme sonrası kardiyovasküler veya lipidik parametrelerde istatistiksel fark olmadığı gözlendi. Testosteron düzeyi YSE içermeyen beslemeden önce 0.29±0.01 ng/ml olarak saptandı. YSE ile beslendikten sonra ise 0.21±0.02 ng/ml olarak bulundu. (P>0.05). Buna karşın, YSE ile beslenme sonrası spermatolojik incelemelerde spermatozoon anomalilerinde önemli oranda bir azalma ile birlikte sperm motilitesinde istatistiksel olarak anlamlı bir artış saptandı. Ortalama sperma hacmi, konsantrasyon, motilite ve toplam spermatozoon anomalileri YSE içermeyen beslenmeden önce sırasıyla; 118.61±8.55 µL, 197.78±12.83x106/ml, 83.33±1.06% ve 27.22±1.33% olarak saptandı. Bu değerler YSE ile beslendikten sonra sırasıyla; 213.06±21.29 ul, 300.56±16.59x106/ml, %90.00±1.07 ve %18.67±0.59 olarak bulundu. Bu değerler arasındaki fark istatistiksel olarak anlamlı bulundu (P<0.001). Bu çalışmanın sonunda, Yucca schidigera ekstraktı içeren ticari kedi maması ile beslenen sağlıklı erkek kedilerde sperm hacmi, konsantrasyon, motilite ve toplam morfolojik bozukluk oranları üzerine yararlı etkileri olabileceği kanısına varıldı. Anahtar sözcükler: Erkek kedi, Yucca schidigera, Sperma, Kardiyak enzimler  İletişim (Correspondence)  +90 212 4737070/17142  haydin@istanbul.edu.tr 186 Semen Characteristics and ... INTRODUCTION have been among the most important research topics in recent years regarding human and animal reproduction. Use of natural herbal extracts known as “Phytomedicines” Furthermore, since it was established that it decreased is growing on the basis of both their aid in the treatment of faecal odour in pet animals, Yucca schidigera has become various diseases as well as their health benefits. Addition very popular as an alternative diet formulation. In other of herbal extracts to animal food products is preferred studies aimed at the use of yucca extracts as an additive, due to their low cytotoxicity and residual properties. weight gain, growth and reproduction in animals were Across the globe, and particularly in the US, the herbal investigated. However, despite its widespread use in pet market is on the rise in the fields of human and animal nutrition, studies on male animal reproduction, in particular, health. Negativities caused by development of resistance are scarce. Research directed at the cardiovascular system and residue in relation to feed additive antibiotics has is also insufficient. The most recent long-term large-scale led the animal nutrition industry to focus on herbal epidemiological study has revealed a strong relationship extracts and oils. There are over 80.000 plants known for between low testosterone levels and deaths related to their bioactive characteristics [1]. Worldwide use of these cardiovascular diseases [14]. The purpose of this study plants in the veterinary field has been documented. In is to contribute to recent studies aiming at drawing Italy [2], reported 280 ethno veterinary plants, while [3] attention to the relationship between the reproductive listed ~ 200 plants with ethno veterinary use in Southern and cardiovascular systems. In this study, effects on Africa. For instance, it is known that aromatic herbs such testosterone, cardiac enzymes and semen characteristics as; fennel, thyme, sage, eucalyptus and cinnamon are in healthy male cats feeding with commercial cat food used in egg poultry and pet food [4]. Echinacea, flaxseed, containing Yucca schidigera extract has been assessed. garlic, ginger, ginseng and yucca are also among herbal supplements given to horses [5]. In recent years, to prevent MATERIAL and METHODS significant economic losses due to mould spoilage in pet food products and human salmonellosis contamination Animals related to these foods, natural plant oils and extracts such as rosemary, oregano and lemongrass have been used [6]. Eighteen healthy shorthair male cats from, approximately Yucca schidigera extract has been used as a feed additive 24-36 months old and 3.5-4.5 kg bodyweight, were used. for a long time in human, equine, livestock and pet diets. The cats were initially fed a commercial cat food for 12 The Federal Drug Administration of the USA has described weeks, which was produced by the Eagle Pack Natural the extract of this plant as safe for human consumption [7,8]. Pet Food Company (Indoor adult dry cat food, Tewksbury, According to the European Commission [9] (EC 1831, 2003), MA, USA) and did not contain the Yucca schidigera plant. regarding feed additives in animal nutrition, phytogenic Following this, a feeding programme was undertaken with compounds have been categorized as “sensory additives” the same cat food containing 150 ppm Yucca schidigera and, in particular, as flavouring compounds, i.e. substances extract (DK Powder-35, produced by Desert King Int. the inclusion of which in feeding stuffs increases feed USA) for 12 weeks and exposed to a 12-h light/dark cycle, smell and palatability. In present day pet industry, Yucca at room temperature. Cats consumed average 60-65 g schidigera is also used as an alternative diet formulation, commercial dry cat food daily and were given drinking particularly to reduce spreading of faecal odour [10]. water ad libitum. The study was approved by the Animal Experimentation Ethics Committee of Istanbul University Scientists have claimed that the Yucca plant is a (Protocol 76/2009). All cat owners were given detailed phytogenic feed additive (PFA) containing steroids, saponins information and signed a research consent form. Food and glycocomponents. Essential oils and spices have ingredients was shown in Table 1. distinct biological functions, such as; antiprotozoal, anti- microbial, or antioxidant properties [8]. Numerous previous Table 1. Chemical and basic composition of commercial cat food* studies have demonstrated the antibacterial effects of Tablo 1. Ticari kedi mamasının temel ve kimyasal içeriği* Yucca schidigera extract on the inhibition of gram-positive Nutritional Level Analysis Values bacteria [11]. Yucca extract supplements have proved to have beneficial effects on the quality of carcass and meat Moisture 10.0% in storage, as well as improving resistance of the immune Crude protein 30.0% system against diseases and reducing mortality. Yucca Crude fat 14.0% products have also been reported to stimulate the laying rate, egg weight and decrease serum glucose, cholesterol Crude fiber 7.3% and triglyceride levels in laying quails [12]. Yucca contains Crude ash 4.9% resveratrol, polyphenolics and other stilbenes (yuccaols A, Mineral matter 2.0% B, C, D and E). Therefore, yucca is used as an antioxidant Metabolizable energy 967 kcal/kg and free-radical scavenger [13]. The positive effects of antioxidants on stress and production of free radicals * taurine, magnesium, omega 3 and omega 6 fatty acids, vitamin A, D3 and E 187 AYDIN VURAL BARAN, BALCI Semen Analysis and were considered to be negative. For cTn-I, values of 0.20 mg/ml and above were considered to be positive and All cats produced ejaculates with 80% progressively measured quantitatively. motile sperm; sperm counts were within normal limits. Semen samples were collected from the animals before Statistical Analysis eating (control) and after a period of 12 weeks feeding with commercial cat food containing YSE. Semen collection Statistical analysis was performed using the SPSS for was performed from January and April using an electro- Window version 21.0 programme (SPSS Inc., Chicago, IL, ejaculator (P-T Electronics, Boring, OR, USA) under general USA). Analysis was performed using Student’s t-test. P<0.05 anesthesia. The volume of the semen was measured using was considered statistically significant. an adjustable automatic micropipette (10-1.000 µL) and the value was recorded in microliters. Sperm motility was RESULTS assessed subjectively (3 µL sample) using phase-contrast microscope at x200 magnification by viewing at least 3 No difference was observed among the male cats fields. An aliquot (5 µL) of semen was diluted with 10% with regard to testosterone levels and mid-piece sperm formol saline and evaluated for total number of sperm morphology after with YSE feeding (P>0.05). The motility using a hemocytometer chamber (Neubauer, Boeco, rate, volume and concentration after with YSE feeding were Hamburg, Germany). A spermac® stain kit (Stain enterprises, observed higher than before with YSE feeding (P<0.001). Onderstepoort, Repuclic of South Africa) was employed Results revealed that there was a statistically significant in sperm morphologic observations. The preparation was positive effect on motility, volume and morphological examined by light microscope at x1.000 magnification properties following feeding on pet food containing Yucca by counting 200 cells (acrosome, head, mid-piece, tail schidigera extract (Table 2). and total abnormal spermatozoa rate) as described by Baran et al.[15]. No statistically significant difference was found between the enzymes CK-MB, cTn-I, total cholesterol and triglyceride Blood Serum Analysis examined to assess the cardiovascular system, before and Blood samples were collected from the animals before after feeding (Table 3). eating (control) and after a period of 12 weeks feeding with commercial cat food containing YSE. In serum samples; DISCUSSION CK-MB, Total cholesterol and Triglyceride levels were measured with the enzymatic method using the Abbott It is necessary to investigate the health effects of C8000 autoanalyser and identical commercial kits. adding natural herbal extracts to animal diets. Haematologic parameters examined during research can provide Cardiac troponin-I (cTnI) and total testosterone levels information on clinical and nutritional status. These were determined using the IMMULITE® commercial kit parameters also aid in diagnosing the metabolic condition (solid-phase, competitive chemiluminescent enzyme of tissues and organ function disorders. In the present study, immunoassay) with an immulite one immunoassay analyzer the haematologic parameters used were; total cholesterol, (DPC, USA). Due to the commercial kit properties, readings triglyceride, troponin and ck-mb levels. The cholesterol- below 0.20 ng/ml could not be measured quantitatively lowering action mechanism of herbal extracts containing Table 2. Means of spermatological traits and testosterone levels of male cats in before (control) and after with Yucca schidigera extract feeding Tablo 2. Yucca schidigera ekstraktlı beslenme öncesi (kontrol) ve sonrasında erkek kedilerin testosterone ve spermatolojik özelliklerinin ortalamaları Parameters Before After Significance Testosterone (ng/ml) 0.29±0.01 0.21±0.02 NS Volume (microliter) 118.61±8.55a 213.06±21.29b P<0.001 Concentration a b (x106/ml) 197.78±12.83 300.56±16.59 P<0.001 Motility (%) 83.33±1.06a 90.00±1.07b P<0.001 Acrosome (%) 15.11±0.90b 10.83±0.83a P<0.01 Head (%) 6.22±0.68b 3.83±0.33a P<0.01 Mid-piece (%) 2.11±0.47 1.33±0.34 NS Tail (%) 3.78±0.41b 2.67±0.38a P<0.05 Total (%) 27.22±1.33b 18.67±0.59a P<0.001 a,b Different superscripts within the same line demonstrate significant differences (n=18); Means±SE, NS: Not significant 188 Semen Characteristics and ... Table 3. Means of creatine kinase-MB, troponin, total cholesterol and triglyceride levels in before (control) and after with Yucca schidigera extract feeding Tablo 3. Yucca schidigera ekstraktlı beslenme öncesi (kontrol) ve sonrasında kreatin kinaz-MB, troponin, toplam kolesterol ve trigliserit düzeylerinin ortalamaları Stage Creatine Kinase-MB (ng/ml) Troponin (ng/ml) Total Cholesterol (mg/dl) Triglyceride (mg/dl) Before control feeding 197.89±7.56 0.16±0.03 109.44±5.81 28.33±3.25 After YSE feeding 194.94±7.58 0.20±0.04 116.56±6.73 24.56±2.76 Significance NS NS NS NS Means±SE, P>0.05 NS: Not significant, (n=18) sterol is based on decreasing and preventing cholesterol containing Yucca schidigera extract. absorption. Some present views state that, plant sterols cause cholesterol to drop in broilers by limiting blood Creatin Kinase myocardial band (CK-MB) is another cholesterol increase and allowing its secretion via bile [4]. cardiac biomarker and it has been reported that it is raised Similarly, Aazami et al.[16] pointed out the cholesterol- in chronic coronary artery occlusion in animals, as well as lowering effect of saponins present in yucca, either in cases of post-surgical tissue damage and renal failure. directly by way of inhibiting small intestinal absorption However, due to its higher sensitivity between cardiac of cholesterol or indirectly by mucosal cell desquamation parameters, cTnI is favoured over CK-MB and troponin C and T [22]or preventing reabsorption of bile acids. There are studies . Based on this information, while the authors demonstrating the presence of a cholesterol-lowering preferred cTnI since it is the most sensitive parameter in effect in goats receiving Yucca schidigera powder compared response to cardiac disorders in cats, in this study, in view to the control group [17]. Mardalena et al.[18] reported of the fact that it may aid in cardiac function assessment, that Yucca schidigera powder possesses an anti-oxidant CK-MB values were also examined and found to be within function and this lowered cholesterol by preventing lipid normal limits. oxidation through its ability to capture free radicals and [14] radical peroxy salts. In this study, while the commercial Consistent with other studies in which testosterone food containing yucca extract was not seen to have a level and cardiac function are related, hormone and triglyceride- and cholesterol-lowering effect in cats, other cardiac parameters were seen to be within normal levels studies suggest that the use of the herb may originate in the present study. Today, the Yucca schidigera plant is from differences in dosage. used as an additive in pet food products. However, there are few studies directed at its reproductive activity. In this Plant compounds cause diverse effects in the cardio- study, semen characteristics examined in the andrological vascular system. There are those that cause cardiac assessment of male cats were; volume (ml), concentration arrhythmias, haemorrhagic syndrome and cardiac necrosis (sperm count/ml), motility (%) and abnormal spermatozoa and this effect is often associated with plant secondary count (%). In healthy male cats fed food containing yucca compounds such as glycosides [19,20]. In this study, in order extract, while sperm volume, concentration and motility to assess cardiac function, the authors utilized cardiac showed a statistically significant increase; acrosome, head, markers used as biomarkers. In veterinary medicine, tail and total morphological abnormalities were found to cardiac troponins are used in the diagnosis and prognosis be statistically lower than pre-administration values. In a of myocardial injury originating from the damage in study [13] determining reproductive activity in rabbits, the myocardial cells. Circulating cardiac troponin I, in particular, powder extract of the whole plant was used at doses of is known to be the most important biomarker - the “gold 5 g/100 kg and 20 g/100 kg. Both doses were found to standard” - in the diagnosis of myocardial injury in cats. It be high compared to semen and progressive motility in has been reported that, it is significantly raised compared the control group. The results of the study are similar to to the control group in hypertrophic cardiomyopathy, the sperm characteristics recorded in the present study. the most important cardiac disease in cats. Also, while a On this subject, there is data regarding the anti-oxidants relationship could not be found between histopathological and free radical scavengers present in yucca improving investigation and diagnosis, it was established that the spermatological responses by aiding in the suppression significantly raised cTnI level was useful and this was of reactive oxygen species. Also, in a study carried out by confirmed by other veterinary practices participating in Baláži et al.[29] it has been demonstrated that yucca intake the study [21,22]. in female rabbits aids in achieving the best birth rate by increasing progressive motility of spermatozoa in genitalia. While cTnI levels are low to non-detectable in healthy mammals, raised cTnI levels have been reported to be Detectability of natural herbal extracts after addition useful myocardial injury biomarkers in calves, cattle, to food is a priority when determining their effects on horses, dogs and lambs [23-28]. In the present study, the cTnI health. In a study [30] carried out in Japan, it was reported level was seen to be normal in healthy cats and no change that only 5-6% of yucca extract used as a food additive was observed in parameters when the cats were fed food contained saponin and over 60% was constituted of 189 AYDIN VURAL BARAN, BALCI unknown substances. In this study it was also reported saponins and Yucca schidigera plant extract on growth of Escherichia that, the extract of this plant is recorded in the food coli. Lett Appl Microbiol, 27, 35-38, 1998. DOI:  10.1046/j.1472-765X. 1998.00379.x additive list in Japan and is included in food as a shelf life 8. EC (European Commission): Regulation 1831 of the European extender. However, no specification has been stated of this Parliament and of the Council of 22 September 2003 on additives for widely used plant as a food additive. In Turkey, it is used use in animal nutrition. Official Journal of European Union Legislation, without any standardization or toxicological assessments. 268/29, 2003. The present study, on the other hand, confirmed that 9. Lowe JA, Kershaw SJ, Taylor AJ, Linforth RST: The effect of Yucca examined parameters showed there to be no negative Schidigera extract on canine and feline faecal volatiles occurring concurrently with faecal aroma amelioration. Res Vet Sci, 63, 67-71, 1997. effects on the cardiovascular system, that the normal DOI: 10.1016/S0034-5288(97)90160-0 levels were preserved in analyses related to testosterone 10. Piacente S, Pizza C, Oleszek W: Saponins and phenolics of Yucca and heart, and concluded that it has a beneficial effect schidigera Roezl: Chemistry and bioactivity. Phytochem Rev, 4, 177-190, on reproduction. 2005. DOI: 10.1007/s11101-005-1234-5 11. Katsunuma Y, Nakamura Y, Toyoda A, Minato H: Effect of Yucca Addition of crude plant extracts or plant mixtures schidigera extract and saponins on growth of bacteria isolated from to food is based mostly on traditional knowledge. It is animal intestinal tract. Anim Sci J, 71, 164-170, 2000. DOI: 10.2508/ necessary for this information to be supported by scientific chikusan.71.164 research. There is a need for scientific research directed 12. Kaya S, Erdogan Z, Erdogan S: Effect of different dietary levels of Yucca schidigera powder on the performance, blood parameters and towards the health effects of plant active components. egg yolk cholesterol of laying quails. J Vet Med A, 50, 14-17, 2003. DOI: In research, dosage, toxicological risk assessment and 10.1046/j.1439-0442.2003.00487.x standardization must be considered and inclusion of 13. Földešiova M, Baláži A, Chrastinová L, Sirotkin A, Chrenek P: Yucca synthetic drugs and feed additives into feeding must be schidigera and its effect on rabbit reproduction. J Microbiol Biotechnol in this direction. Food Sci, 3 (3): 253-254, 2013. 14. Akishita M, Hashimoto M, Ohike Y, Ogawa S, Lijima K, Eto M, In keeping with present day animal production processes, Yasuyoshi Ouchi Y: Low testosterone level as a predictor of cardiovascular events in Japanese men with coronary risk factors. Atherosclerosis, 210, the main scope in pet food industry is to promote better 232-236, 2010. DOI: 10.1016/j.atherosclerosis.2009.10.037 quality of life through an eco-friendly clean and natural 15. Baran A, Sahin BE, Evecen M, Demir K, Ileri IK: Use of Spermac® mission. The current study shows that the used herbal staining technique in the determination of acrosomal defects in cat extract has no long-term negative effects. Moreover, it semen. Turk J Vet Anim Sci, 28 (3): 519-525, 2004. has positive effects on semen characteristics in male cats. 16. Aazami MH, Tahmasbi AM, Ghaffari MH, Naserian AA, Valizadeh Nevertheless, there are deficiencies regarding suitable R, Ghaffari AH: Effects of saponins on rumen fermentation, nutrients digestibility, performance, and plasma metabolites in sheep and goat dosage, determining phytochemical composition and kids. Annual Rev Res Biol, 3 (4): 596-607, 2013. mechanism of action in the use of feed additives. 17. Khalifa EI, Hassanien HAM, Mohamed AH, Abdel-El-Magied A: Effects of using Yucca schidigera powder as feed additive on productive It was concluded at the end of the study that the and reproductive efficiency of zaraibi dairy goats. Egyptian J Sheep Goat commercial cat food containing Yucca schidigera extract Sci, 9 (2): 9-21, 2014. (150 ppm) could be beneficial effects of the sperm volume, 18. Mardalena M, Warly L, Nurdin E, Rusmana WSN, Farizal F: Milk concentration, motility and total morphological defect quality of dairy goat by giving feed supplement as antioxidant source. rates in healthy male cats. J Ind Trop Anim Agr, 36 (3): 205-211, 2011. 19. Aslani MR, Maleki M, Mohri M, Sharifi K, Najjar-Nezhad V, Afshari E: Castor bean (Ricinus communis) toxicosis in a sheep flock. Toxicon, 49, REFERENCES 400-406, 2007. DOI: 10.1016/j.toxicon.2006.10.010 20. Ingebrigtsen K: Main plant poisonings in livestock in the Nordic 1. Joy PP, Thomas J, Mathew S, Skaria BP: Medicinal plants. In, Bose TK, countries. In, Bioactive compounds in plants - Benefits and risks for man Kabir J, Das P, Joy PP (Eds): Tropical Horticulture. 449-632, Naya Prokash, and animals. Norwegian Acad Sci Lett, 30-43, 2010. Calcutta, India, 2001. 21. Herndon WE, Kittleson MD, Sanderson K, Drobatz KJ, Clifford CA, 2. Viegi L, Pieroni A, Guarrera PM, Vangelisti R: A review of plants Gelzer A, Summerfield NJ, Linde A, Sleeper MM: Cardiac troponin I in used in folk veterinary medicine in Italy as basis for a databank. J feline hypertrophic cardiomyopathy. J Vet Int Med, 16, 558-564, 2002. DOI: Ethnopharmacol, 89, 221-244, 2003. DOI: 10.1016/j.jep.2003.08.003 10.1111/j.1939-1676.2002.tb02387.x 3. McGaw LJ, Eloff JN: Ethno veterinary use of southern African plants 22. Sleeper MM, Clifford CA, Laster LL: Cardiac troponin I in the and scientific evaluation of their medicinal properties. J Ethnopharmacol, normal dog and cat. J Vet Int Med, 15, 501-503, 2001. DOI: 10.1111/j.1939- 119, 559-574, 2008. DOI: 10.1016/j.jep.2008.06.013 1676.2001.tb01582.x 4. Cakir S, Yalcin S: Factors on the egg cholesterol levels. J Lalahan Anim 23. Baker JO, Reinhold J, Redwood S, Marber MS: Troponins: Redefining Res Inst, 44 (1): 51-63, 2004. their limits. Heart, 97, 447-452, 2011. DOI: 10.1136/hrt.2010.205617 5. Williams CA, Lamprecht ED: Some commonly fed herbs and other 24. Gunes V, Ozcan K, Citil M, Onmaz AC, Erdogan HM: Detection functional foods in equine nutrition: A review. Vet J, 178, 21-31, 2008. DOI: of myocardial degeneration with point-of-care cardiac troponin assays 10.1016/j.tvjl.2007.06.004 and histopathology in lambs with white muscle disease. Vet J, 184, 376- 6. Bianchini A, Stratton J, Weier S, Cano C, Garcia LM: Use of essential 378, 2010. DOI: 10.1016/j.tvjl.2009.03.001 oils and plant extracts to control microbial contamination in pet 25. Varga A, Schober KE, Holloman CH, Stromberg PC, Lakritz J, Rings food products. J Food Proc Technol, 5, 1-9, 2014. DOI: 10.4172/2157- DM: Correlation of serum cardiac troponin I and myocardial damage in 7110.1000357 cattle with monensin toxicosis. J Vet Int Med, 23, 1108-1116, 2009. DOI: 7. Sen S, Makkar HPS, Muetzel S, Becker K: Effect of Quillaja saponaria 10.1111/j.1939-1676.2009.0355.x 190 Semen Characteristics and ... 26. La Vecchio D, Marin LM, Baumwart R, Iazbik MC, Westendorf exercise is associated with increased plasma cardiac troponin I in horses. N, Couto CG: Serum cardiac troponin I concentration in retired racing Equine Vet J, 36, 27-31, 2006. DOI: 10.1111/j.2042-3306.2006.tb05508.x greyhounds. J Vet Int Med, 23, 87-90, 2009. DOI: 10.1111/j.1939- 29. Baláži A, Földešiová M, Chrastinová L, Sirotkin AV, Chrenek P: 1676.2008.0237.x Effect of herbal additive Yucca on rabbit spermatozoa characteristic. J 27. Tunca R, Sozmen M, Erdogan H, Citil M, Uzlu E, Ozen H, Gokce E: Microbiol Biotechnol Food Sci, 2 (Special Issue) 1829-1837, 2013. Determination of cardiac troponin I in the blood and heart of calves with 30. Uematsu Y, Hirata K, Saito K, Kudo I: Spectrophotometric foot-and-mouth disease. J Vet Diag Invest, 20 (5): 598-605, 2008. determination of saponin in yucca extract used as food additive. J AOAC 28. Holbrook TC, Birks EK, Sleeper MM, Durando M: Endurance Inter, 83 (6): 1451-1454, 2000. Kafkas Univ Vet Fak Derg KafKas Universitesi veteriner faKUltesi Dergisi 22 (2): 191-195, 2016 JoUrnal Home-Page: http://vetdergi.kafkas.edu.tr Research Article DOI: 10.9775/kvfd.2015.14065 online sUbmission: http://vetdergikafkas.org Critical Thresholds of Nonesterified Fatty Acids and β-hydroxybutyrate in Transition Dairy Cows for Prediction of First Service Conception Rate Maryam KARIMI DEHKORDI 1 Ali KADIVAR 2 Taghi TAKTAZ HAFSHEJANI 3 1 Department of Clinical Pathology, Faculty of Veterinary Medicine, Shahrekord Branch, Islamic Azad University, Shahrekord - IRAN 2 Department of Clinical Science, Faculty of Veterinary Medicine, Shahrekord University, Shahrekord - IRAN 3 Department of Veterinary Reproduction and Obstetrics, Faculty of Veterinary Medicine, Shahrekord Branch, Islamic Azad University, Shahrekord - IRAN Article Code: KVFD-2015-14065 Received: 18.07.2015 Accepted: 18.01.2016 Published Online: 19.01.2016 Abstract The objective of this study was to establish cow level critical thresholds for β-hydroxybutyrate (BHBA) and nonesterified fatty acids (NEFA) to predict conception to first service. The data were generated from 97 Holstein cows (2 to 5 parities) on a large commercial farm. Serum concentrations of BHBA and NEFA were measured in all cows on day 10 prepartum and, weeks 1, 2, 4 and 6 postpartum. NEFA and BHBA analyzed with receiver operator characteristic (ROC) analysis to determine critical thresholds for predicting pregnancy to first service. NEFA in weeks 4 and 6 postpartum were the only significant predictors identified in the ROC analysis. Optimum critical thresholds for NEFA in weeks 4 and 6 were 201.15 µmol/L and 203.4 µmol/L, respectively (P<0.05). The critical threshold for serum BHBA in the prepartum cohort was 600 µmol/L (P=0.1), which predicted conception to first service. Logistic regression analysis indicated that the risk of conceiving was 82.4% and 88.6% lower for cows with NEFA ≥201.15 in week 4 (OR=0.176; P=0.001) and NEFA ≥203.4 µmol/L in week 6 (OR=0.114; P=0), respectively. In conclusion, NEFA concentrations within 4 and 6 weeks after calving were associated with lower probability of pregnancy at the first AI. Keywords: Dairy cow, Nonesterified fatty acids, β-hydroxybutyrate, First service conception Geçiş Dönemi Sütçü İneklerde İlk Tohumlamada Gebe Kalma Oranını Tahmin Etmede Esterlenmemiş Yağ asitleri ve β-hidroksibütirat Kritik Eşik Değerleri Özet Bu çalışmanın amacı ineklerde ilk tohumlamada gebe kalma oranını tahmin etmede β-hidroksibütrat (BHBA) ve esterlenmemiş yağ asitleri (NEFA) kritik eşik değerlerini belirlemektir. Çalışmanın verileri ticari büyük bir çiftlikte 97 adet Holstein ırkı inekten (2 ile 5 parite) elde edildi. Tüm ineklerde BHBA ve NEFA serum konsantrasyonları prepartum 10. günde ve postpartum 1, 2, 4 ve 6. haftalarda ölçüldü. BHBA ve NEFA ilk tohumlamada gebe kalma eşik değerini belirlemek amacıyla Receiver Operator Characteristic (ROC) ile analiz edildi. Postpartum 4. ve 6. haftalardaki NEFA ROC analizinde belirlenen tek anlamlı değerlerdi. 4. ve 6. haflarda NEFA için optimal kritik eşik değerleri sırası ile 201.15 µmol/L ve 203.4 µmol/L olarak tespit edildi (P<0.05). Prepartum grubunda serum BHBA için kritik eşik 600 µmol/L (P=0.1) olarak belirlendi. Lojistik regresyon analizi ile gebe kalma riski 4. haftada NEFA ≥201.15 ineklerde (OR=0.176; P=0.001) %82.4 ve 6. haftada NEFA ≥203.4 µmol/L ineklerde (OR=0.114; P=0) %88.6 daha düşük olarak belirledi. Sonuç olarak, doğumdan sonra 4 ve 6. haftalarda NEFA konsantrasyonları ilk suni tohumlamada gebe kalma olasılığı ile düşük derecede ilişkilidir. Anahtar sözcükler: Süt ineği, Esterlenmemiş yağ asitleri, β-hidroksibütrat, İlk tohumlamada gebelik INTRODUCTION shortly before parturition, and 3) lagging DMI compared with energy demands due to milk production [1,2]. Most transition dairy cows enter a state of negative Body fat stores are mobilized into the bloodstream in energy balance (NEB) for three important reasons: 1) the form of nonesterified fatty acids (NEFAs) because of increased energy demands at parturition, 2) decreased DMI increased energy demand and decreased DMI and contribute  İletişim (Correspondence)  +98 383 3361045, Fax: +98 383 3361060  maryam.karimi@iaushk.ac.ir 192 Critical Thresholds of ... to overall energy requirements during early lactation, Statistical Analysis some of which is taken up by the liver. In the liver, some NEFA are oxidized or re-esterified into triglycerides that Receiver Operator Characteristic (ROC) Analysis for Critical are either exported as very low density lipoproteins or Thresholds: In this study, BHB and NEFA in different times stored in the liver. During the periparturient period, high were evaluated with receiver operator characteristic rates of NEFA enter the liver and sometimes exceed the (ROC) analysis in order to determine critical thresholds for liver’s capacity to secrete triglycerides as very low density predicting conception. lipoproteins, leading to an accumulation of triglycerides [3]. The ROC curves analyze sensitivity versus 100 - specifi- Increased amounts of NEFA that are removed by the liver city. Sensitivity was the proportion of animals conceived at control ketogenesis and thus, β-hydroxybutyrate (BHBA) first service that were below a given metabolite threshold, production [4]. and specificity was the proportion of animals that did not At the cow level, increased BHBA and NEFA concentrations conceive that was above a given threshold [10]. have been used as markers of excessive NEB. Previous studies have indicated that increased concentrations The point on the ROC curve that had the highest of these metabolites are related to increased risk of combined sensitivity and specificity was considered the developing detrimental health [5,6], reproductive [7,8], and critical threshold. In this analysis, there is an area under the production outcomes [9]. curve (AUC) and a P-value for each parameter in different times. The value of P indicates if this parameter is an The aims of this research are the followings: 1) to specify appropriate indicator for prediction of conception or not? whether concentrations of BHBA and NEFA measured at Interpretation of this critical threshold was based on the 10 days prepartum and in each of the first, second, fourth area under the curve (AUC) such that if the AUC=0.5, it and sixth weeks postpartum could be used at herd level to was noninformative; if 0.5 < AUC ≤ 0.7, it was accurate; if predict success of conception to first service and in which 0.7 < AUC ≤ 0.9, it was very accurate; if 0.9 < AUC < 1, it times relative to calving were most effective in predicting was highly accurate; and if AUC = 1, then it was considered fertility; 2) to determine the cutoff point of NEFA and BHB perfect [11]. concentrations for diagnosis of conception using receiver operating characteristic (ROC) analysis. Logistic regression: The odds ratios (OR) of conception to first service outcome given NEFA or BHBA concentrations were modeled with multivariable regression techniques, MATERIAL and METHODS accounting for clustering of cows within herds. Study Population and Design Univariable analyses were first performed to assess the association between pregnancy at the first AI and The study was conducted on 97 lactating Holstein cows categorical cow-level covariates (calf sex, calf weight, of parities two to five in a large commercial dairy herd, in parity, BCS, BCS loss from calving to first service, postcalving Chaharmahal and Bakhtiari province of Iran. In this study, clinical disease, and occurrence of dystocia) with t-test as a cows have fed a TMR-based diet (All diets were based random effect. Parity was categorized into 2 and more than on alfalfa, corn silage, and a combination of concentrate 2. Body condition score loss was categorized as less than including corn, soya meal and bone meal). one unit and one or more than one unite. A binary disease Seasonal effects were minimized as most of the cows on variable was created and coded 1 if a cow was diagnosed farm calved during a one-hundred-day period from August with dystocia, retained placenta, metritis, endometritis, until November in 2014. Blood samples were collected at 5 ovarian cyst or at least one of these disease before 30 to 6 a.m. (before feeding) on day 10 prepartum and weeks DIM. Variables that were not associated with pregnancy one, two, four and six postpartum, via the tail vein into a at the first AI in the univariable analysis (P>0.0.05) were not glass tube. considered further. Blood samples were left to clot at room temperature for For each significant metabolite and week of sampling about thirty minutes and then centrifuged at 2.000×g. The in ROC analysis, dichotomized metabolites concentrations obtained serum samples were kept at -20°C until analyzed based on determined thresholds and significant covariates for BHBA and NEFA concentrations. These metabolites in the univariable analysis were submitted to multivariable were determined by a D-3-hydroxybutyrate kit and a NEFA logistic regression, using a binary distribution. The predicted Kit (Randox Laboratories Ltd, Ardmore, UK). The cows were probabilities of pregnancy were estimated from the model. inseminated by an expert inseminator when standing heat was observed. Pregnancy diagnosis was performed RESULTS by ultrasonography 30 to 40 days after service and the second palpation was done two weeks later to validate Conception rate to first service was 29% (28/97). The the pregnancy. present study revealed several relationship estimates 193 KARIMI DEHKORDI, KADIVAR TAKTAZ HAFSHEJANI between traits and fertility that were statistically significant most likely conceived than cows with concentrations at (P<0.05) or tended to be significant (P=0.1). or above the same thresholds). Parity and body condition score loss from calving to Measures of Association first service were associated with the odds of pregnancy at first AI in univariable analyses whereas sex, weight, the Odds ratios (OR) were calculated based on critical mean of BCS, postcalving clinical disease and dystocia thresholds determined by ROC analysis. When NEFA was were not significantly different between pregnant and not evaluated as the only main predictor (i.e., without BHB pregnant cows after first service. First service conception in the model) and after controlling for parity and BCS rate progressively decreased from 33.7% for cows losing loss, the odds of conceiving were 82.4% and 88.6% lower <1 unit of BCS to 10% for cows losing ≥1 unit of BCS from for cows with NEFA ≥201.15 (OR=0.176; P=0.001) and calving to first service (P=0.03). Also when cows were NEFA ≥203.4 µmol/L (OR=0.114; P=0) in weeks 4 and divided in to parity 2 (n=54) and ≥3 (n=43), cows with 6 postpartum, respectively. second parity had significantly higher conception rate compared with older cows (37% vs. 18%; P<0.05). DISCUSSION Critical Thresholds This study was an analysis of the association of serum NEFA and BHBA analyzed with ROC curves to determine metabolites in the transition period with early lactation the cow-level critical thresholds (combined highest sensitivity reproductive performance on commercial dairies. This and specificity) to predict conception to first service. Non- study was done in a commercial dairy farm with about esterified fatty acids in weeks 4 and 6 postpartum, was the 1450 lactating dairy cows in a mountainous area in Iran. only significant predictor identified in the ROC analysis. Conception rate to first service on our farm was 29% which Tabular results of ROC curve determination of critical was the same as that of (27%) reported recently for 87 BHB and NEFA thresholds (µmol/L) for the prediction of Iranian dairy cows by Kadivar et al.[12]. conception are in Table 1 and 2. In summary, optimum critical threshold that had the highest combined sensitivity The results showed no significant association between and specificity, for prepartum BHB was 600 µmol /L BHBA concentrations and the odds of pregnancy at first AI. (P=0.1) and for NEFA in weeks 4 and 6 were 201.15 µmol/L However, as far as we know, this is the first study which has (P=0.04) and 203.4 µmol/L (P=0.01), respectively, with 16.5, reported an association (P=0.1) between precalving BHBA 51.5 and 49.5% of the animals at or above the threshold. All and reproductive performance. The optimal threshold of metabolite concentrations below these thresholds were ≥600 μmol/L for predicting a reduction in reproductive associated with higher reproduction performance (i.e., performance was the same as that associated with a cows with NEFA concentrations below related thresholds decreased milk yield in Chapinal et al.[13]. This finding is Table 1. Receiver operator characteristic curve determination of critical BHB thresholds as predictors of conception in transition dairy cows Tablo 1. Geçiş dönemi ineklerde gebe kalma tahmini amacıyla kritik BHB eşik değerleri Receiver operator characteristic eğrisinin belirlenmesi Pregnancy Status Critical Threshold1 Se2 Sp3 AUC4 P-value Before parturition 421.55 53.6 30.4 0.605 0.1 Week 1 621.05 53.6 47.8 0.497 0.9 Week 2 480.7 53.6 42 0.502 0.9 Week 4 453.35 64.3 47.8 0.452 0.4 Week 6 468 60.7 47.8 0.487 0.8 1 Highest combined specificity (Sp) and sensitivity (Se), µmol/L; 2 Se = epidemiologic sensitivity; 3 Sp = epidemiologic specificity; 4 AUC = area under the curve Table 2. Receiver operator characteristic curve determination of critical NEFA thresholds as predictors of conception in transition dairy cows Tablo 2. Geçiş dönemi ineklerde gebe kalma tahmini amacıyla kritik NEFA eşik değerleri Receiver operator characteristic eğrisinin belirlenmesi Pregnancy Status Ccritical Threshold1 Se2 Sp3 AUC4 P-value Before parturition 133.5 57.1 47.8 0.486 0.8 Week 1 673.95 57.1 53.6 0.495 0.9 Week 2 466.65 60.7 46.4 0.490 0.8 Week 4 201.15 78.6 63.8 0.628 0.04 Week 6 203.4 85.7 63.8 0.654 0.01 1 Highest combined specificity (Sp) and sensitivity (Se), µmol/L; 2 Se = epidemiologic sensitivity; 3 Sp = epidemiologic specificity; 4 AUC = area under the curve 194 Critical Thresholds of ... very interesting because, in contrast to NEFA, ketones can al.[16] did not report any significant relationships between be simply measured in the field [14]. NEFA concentration and fertility. The optimal threshold of ≥ 600 μmol/L was somewhat After considering the stage of sampling in which lower than the threshold of 800 μmol/L associated with an significant relationships were observed, we note that increased risk of displaced abomasum in Chapinal et al.[15]. these relationships were found in the last weeks of sampling, when the most animals were already cyclic. Walsh et al.[7] determined BHBA concentration thres- This is completely reasonable because this is the time that holds for the prediction of probability of pregnancy after the most of the cows were inseminated for the first time the first insemination early in lactation. They showed that and energy balance indicators are expected to be more cows with serum BHBA 1000 µmol/L in the first week or informative in this period. 1400 µmol/L in the second week were significantly less probably to be diagnosed pregnant after first insemination. An association between reproductive efficiency in early lactation and elevated peripartum NEFA was reported The same association between fertility and BHBA by Ospina [8]. In all animals sampled prepartum, the risk of concentration has been reported by Ospina et al.[8]. In their pregnancy within 70 d post-VWP was reduced by 19% when study, in animals which were sampled postpartum, the risk NEFA concentrations were ≥270 µmol/L. In all animals of pregnancy within 70 days post-voluntary waiting period sampled postpartum, those with NEFA concentrations (VWP) was reduced by 13% when BHBA concentrations ≥720 µmol/L had a 16% decrease in risk of pregnancy. were 970 µmol/L. On the other hand, these thresholds are related to the In our study, mean BHBA concentration in all sampling assessment of conception within 70 days post-voluntary times were lower than threshold values reported by Walsh waiting period (VWP). The level at which elevated NEFA is et al.[7] and Ospina et al.[6] that above this, risk of pregnancy associated with conception at first service was not evaluated. after first service is reduced. This fact can point out why BHBA did not affect the probability of pregnancy in this Although elevated concentrations of both NEFA and study. In agreement with our results, Fahey et al.[16], Waters BHBA decline the risk of conception, through direct toxic et al.[17] and Falkenberg et al.[18] did not report any significant effect on the follicles with induction of cumulus cells relationship between peripartum BHBA concentrations apoptosis, necrosis and follicular development arrest [25,26], and reproductive parameters. Moreover, detrimental effects however, in our study, NEFA concentration was found of ketonebodies on reproductive success rely on the to have the stronger relationship with reproductive longevity of their increased levels [19]. In this study, the performance than BHBA. This situation is likely because of duration of increasing BHBA concentration may be too the more direct physiological relationship between NEFA short to have a negative effect on fertility. Therefore, under concentrations and negative energy balance [27]. the conditions of the present study, this variate is not likely to be useful predictors of reproductive performance. The current analysis allowed the opportunity to examine the effect of elevated concentrations of pre- and In the current study, higher NEFA concentrations in postpartum NEFA and BHBA on reproduction at the cow weeks 4 and 6 postcalving were associated with decreased level. In summary, elevated serum concentrations of BHB odds of pregnancy which showed that a moderate degree within 1 week before calving and NEFA in weeks 4 and 6 of fat mobilization in these times of lactation may be critical after calving were associated with lower probability of to get low performance. This shows that postpartum pregnancy at the first AI in the present study. NEFA concentration is a dependable indicator for defining conception status after the first service. Establish cow level critical thresholds for serum concentrations of NEFA and BHBA to predict conception The optimal thresholds in these two times were 201.15 at first service was a notable feature of the current study. µmol/L and 203.4 µmol/L, respectively. Excessive magnitude The following cow-level critical thresholds should be or rate of mobilization of fat supplies will cause suboptimal considered general guidelines for monitoring cattle: NEFA metabolic performance and is likely an indicator of a concentrations ≥201.15 µmol/L for cattle in week 4 post- reduced adaptive response to NEB. partum; and NEFA concentrations ≥203.4 µmol/L for cattle in week 6 postpartum. Both postpartum NEFA concentrations A number of studies have focused on the relationship above these critical thresholds were associated with between NEFA concentrations and reproductive perfor- decreased occurrence for conception at first service. mance [20-22]. The negative impact of NEFA concentration on commencement of luteal activity postpartum was This information allows the identification of individual reported during the 4 and 7 week of lactation [21]. A delay in cows at risk for this downstream outcomes based on their the resumption of ovulation limits the number of oestrous NEB status during the transition period. Recognizing cows cycles before service, which may lead to the reduced at risk for decreased PR based on the effects of increased conception rates [23]. However, Reist et al.[24] and Fahey et NEFA or BHBA concentrations during the transition period 195 KARIMI DEHKORDI, KADIVAR TAKTAZ HAFSHEJANI may help farmers focus on improving herd energy balance. Pathol, 21 (5): 589-596, 2012. Thus, it is necessary to improvement in management of 13. Chapinal N, Carson ME, LeBlanc SJ, Leslie KE, Godden S, Capel M, transition cows so as to minimize the effect of NEB. Santos JEP: The association of serum metabolites in the transition period with milk production and early-lactation reproductive performance. J Efforts to improve NEB status should be implemented Dairy Sci, 95, 1301-1309, 2012. DOI: 10.3168/jds.2011-4724 at the herd level, where decisions about nutritional 14. Carrier J, Stewart S, Godden S, Fetrow J, Rapnicki P: Evaluation and use of three cowside tests for detection of subclinical ketosis in early management, diet, comfort, social adaptation, and access postpartum cows. J Dairy Sci, 87, 3725-3735, 2004. DOI:  10.3168/jds. to feed, which may be the best methods of minimizing S0022-0302(04)73511-0 the lagging DMI during the transition period, which is one 15. Chapinal N, Carson M, Duffield TF, Capel M, Godden S, Overton of the major factors associated with NEB. M, Santos JEP, LeBlanc SJ: The association of serum metabolites with clinical disease during the transition period. J Dairy Sci, 94, 4897-4903, REFERENCES 2011. DOI: 10.3168/jds.2010-4075 16. Fahey J, Mee JF, O’Callaghan D: Can blood metabolites, body 1. Gerloff BJ: Dry cow management for the prevention of ketosis and condition and milk production be used to predict reproductive performance fatty liver in dairy cows. Vet Clin North Am: Food Anim Pract 16, 283-292, in dairy cows? Ir Vet J, 54, 572-577, 2001. 2000. DOI: 10.1016/S0749-0720(15)30106-7 17. Waters S, Morris DG, Diskin MG: The association between circulating 2. Hayirli A, Grummer RR, Nordheim EV, Crump PM: Animal and metabolic hormones during the early postpartum period and subsequent dietary factors affecting feed intake during the prefresh transition period fertility in dairy cow. Research Report RMIS, 5679, 145-148, 2006. in Holsteins. J Dairy Sci, 85, 3430-3443, 2002. DOI:  10.3168/jds.S0022- 18. Falkenberg U, Haertel J, Rotter K, Iwersen M, Arndt G, Heuwieser 0302(02)74431-7 W: Relationships between the concentration of Insulin-Like Growth 3. Drackley JK, Overton TR, Douglas GN: Adaptations of glucose Factor-1 in serum in dairy cows in early lactation and reproductive and long chain fatty acid metabolism in liver of dairy cows during performance and milk yield. J Dairy Sci, 91, 3862-3868, 2008. DOI: 10.3168/ the periparturient period. J Dairy Sci, 84 (E Suppl.): E100-E112, 2001. jds.2007-0887 DOI: 10.3168/jds.S0022-0302(01)70204-4 19. Miettinen PV: Metabolic balance and reproductive performance 4. Hegardt FG: Mitochondrial 3-hydroxy-3-methylglutaryl-CoA synthase: in Finnish dairy cows. Zentralbl Veterinarmed, 37, 417-424, 1990. DOI: A control enzyme in ketogenesis. Biochem J, 338, 569-582, 1999. DOI: 10.1111/j.1439-0442.1990.tb00923.x 10.1042/bj3380569 20. Hayhurst C, Sorensen MK, Royal MD, Lovendahl P: Metabolic 5. LeBlanc SJ, Leslie KE, Duffield TF: Metabolic predictors of displaced regulation in Danish bull calves and the relationship to the fertility of abomasum in dairy cattle. J Dairy Sci, 88, 159-170, 2005. DOI:  10.3168/jds. their female offspring. J Dairy Sci, 90, 3909-3916, 2007. DOI: 10.3168/ S0022-0302(05)72674-6 jds.2006-731 6. Ospina PA, Nydam DV, Stokol T, Overton TR: Evaluation of 21. Wathes DC, Bourne N, Cheng Z, Mann GE, Taylor VJ, Coffey MP: nonesterified fatty acids and β-hydroxybutyrate in transition dairy cattle in Multiple correlation analyses of metabolic and endocrine profiles with the northeastern United States: Critical thresholds for prediction of clinical fertility in primiparous and multiparous cows. J Dairy Sci, 90, 1310-1325, diseases. J Dairy Sci, 93, 546-554, 2010. DOI: 10.3168/jds.2009-2277 2007. DOI: 10.3168/jds.S0022-0302(07)71619-3 7. Walsh RB, Walton JS, Kelton DF, LeBlanc SJ, Leslie KE, Duffield 22. Burkhart M, Youngquist R, Spain J, Sampson J, Bader J, Vogel TF: The effect of subclinical ketosis in early lactation on reproductive R, Lamberson W, Garverick A: NEFE and glucose levels in serum of performance of postpartum dairy cows. J Dairy Sci, 90, 2788-2796, 2007. periparturient dairy cows are indicative of pregnancy success at first DOI: 10.3168/jds.2006-560 service. J Dairy Sci, 88 (Suppl. 1): 299, 2005. 8. Ospina PA, Nydam DV, Stokol T, Overton TR: Associations of 23. Butler WR, Smith RD: Interrelationships between energy balance elevated nonesterified fatty acids and β-hydroxybutyrate concentrations and postpartum reproductive function in dairy cattle. J Dairy Sci, 72, 767, with early lactation reproductive performance and milk production in 1989. DOI: 10.3168/jds.S0022-0302(89)79169-4 transition dairy cattle in the northeastern United States. J Dairy Sci, 93, 24. Reist M, Koller A, Busato A, Kupfer U, Blum JW: First ovulation 1596-1603, 2010. DOI: 10.3168/jds.2009-2852 and ketone body status in the early postpartum period of dairy cows. 9. Duffield TF, Lissemore KD, McBride BW, Leslie KE: Impact of Theriogenology, 54, 685-701, 2002. DOI: 10.1016/S0093-691X(00)00383-6 hyperketonemia in early lactation dairy cows on health and production. 25. Friggens NC: Body lipid reserves and the reproductive cycle: Towards J Dairy Sci, 92, 571-580, 2009. DOI: 10.3168/jds.2008-1507 a better understanding. Livest Prod Sci, 83, 219-236, 2003. DOI: 10.1016/ 10. Greiner M, Pfeiffer D, Smith RD: Principles and practical application S0301-6226(03)00111-8 of the receiver-operating characteristic analysis for diagnostic tests. 26. Jorritsma R, Cesar ML, Hermans JT, Kruitwagen CLJJ, Vos PLAM, Prev Vet Med, 45, 23-41, 2000. DOI: 10.1016/S0167-5877(00)00115-X Kruip TAM: Effects of non-esterified fatty acids on bovine granulosa cells 11. Swets JA: Measuring the accuracy of diagnostic systems. Science, and developmental potential of oocytes in vitro. Anim Reprod Sci, 81, 225- 240, 1285-1293, 1988. DOI: 10.1126/science.3287615 235, 2004. DOI: 10.1016/j.anireprosci.2003.10.005 12. Kadivar A, Ahmadi MR, Gheisari HA, Nazifi S: Relationship among 27. Herdt TH: Ruminant adaptation to negative energy balance. Influences Insulin-Like Growth Factor I some metabolite concentrations in prepartum on the etiology of ketosis and fatty liver. Vet Clin North Am: Food Anim and Reproductive function in Holstein Friesian dairy cows. Comp Clin Pract, 16, 215-230, 2000. DOI: 10.1016/S0749-0720(15)30102-X Kafkas Univ Vet Fak Derg KafKas Universitesi veteriner faKUltesi Dergisi 22 (2): 197-202, 2016 JoUrnal Home-Page: http://vetdergi.kafkas.edu.tr Research Article DOI: 10.9775/kvfd.2015.14084 online sUbmission: http://vetdergikafkas.org The Distribution and Heterogeneity of Mast Cells in the Cecum of Quail (Coturnix Coturnix Japonica) [1] Mustafa YILDIZ 1 Işıl AYDEMİR 2 Şadiye KUM 3 Ülker EREN 3 [1] A part of the study was presented as a thematic presentation at the 10th National Congress of Histology and Embryology, May 17-20, 2010, Çeşme /İzmir, Turkey 1 Gynecology - Obstetrics and Pediatrics Hospital, TR-09020 Aydın - TURKEY 2 Department of Histology and Embryology, Institute of Health Sciences, Celal Bayar University, TR-45030 Manisa - TURKEY 3 Department of Histology and Embryology, Faculty of Veterinary Medicine, Adnan Menderes University, TR-09000 Aydın - TURKEY Article Code: KVFD-2015-14084 Received: 23.07.2015 Accepted: 01.12.2015 Published Online: 03.12.2015 Abstract The aim of the present study is to investigate the location and heterogeneity of mast cells in quail cecum. Cecum samples were fixed in basic lead acetate (BLA), Carnoy’s, isotonic formaldehyde acetic acid (IFAA) and 10% neutral buffered formalin (NBF) solutions. The sections were stained with an alcian blue-critical electrolyte concentration (AB-CEC) (pH 5.8, 0.3 M MgCl2) and safranin O (SO) (pH 1.0) used in a combined method and with toluidine blue (TB) (pH 0.5). Mast-cell population was shown in highest ratios in all layers of Carnoy fixed cecum parts within TB-stained sections. Metachromatic mast cell density was determined the most in tunica mucosa layers of the middle and distal cecum. It was seen that AB-CEC (+)/SO (-) mast-cell density was greater in tunica mucosa layers of the proximal and middle cecum in IFAA and BLA fixed tissues campare to Carnoy fixation. At the end of the study; it can be said that Carnoy solution fixed the connective tissue mast cells, as well as IFAA and BLA solutions fixed the mucosal mast cells better. Keywords: Cecum, Fixative solution, Mast cell, Quail Bıldırcın (Coturnix Coturnix Japonica) Sekumunda Mast Hücrelerinin Dağılımı ve Heterojenitesi Özet Sunulan çalışmanın amacı, bıldırcın sekumunda mast hücrelerinin yerleşimini ve heterojenitesini araştırmaktır. Sekum örnekleri bazik kurşun asetat (BLA), Carnoy, izotonik formaldehit asetik asit (IFAA) ve %10’luk nötr tamponlu formalin (NBF) solüsyonlarında tespit edildi. Kesitler alsiyan mavisi-kritik elektrolit konsantrasyonu (AB-CEC) (pH 5.8, 0.3 M MgCl2)/safranin O (SO) (pH 1.0) kombine metodu ve toluidin mavisi (TB) (pH 0.5) ile boyandı. Mast hücresi populasyonu, TB ile boyanmış kesitlerde Carnoy solüsyonu ile tespit edilen sekum bölümlerinin bütün katmanlarında en yüksek oranlarda gösterildi. Metakromatik mast hücresi yoğunluğu en fazla orta ve distal sekumun tunika mukoza katmanlarında belirlendi. AB-CEC (+)/SO (-) mast hücresi yoğunluğunun ise, Carnoy tespitine göre IFAA ve BLA ile tespit edilen dokularda, proksimal ve orta sekumun tunika mukoza katmanlarında daha fazla olduğu görüldü. Araştırma sonunda; bıldırcın sekumunda Carnoy tespit solüsyonunun bağ doku mast hücrelerini, IFAA ve BLA tespit solüsyonlarının ise mukozal mast hücrelerini daha iyi tespit ettiği söylenebilir. Anahtar sözcükler: Sekum, Tespit solüsyonu, Mast hücresi, Bıldırcın INTRODUCTION dioxide [4] and nutrients [2]. Additionally, it contains diffuse and nodular lymphatic tissues in its submucosa and The avian cecum consists of two blind-ended sacs lamina propria. It therefore acts as a defensive organ [5]. located on the right and left of the juncture between the These lymphatic tissues are called as cecal tonsils, and they small and large intestines [1,2]. It comprises three parts, the are located in the proximal region of the cecum [6]. proximal, middle and distal [3], and plays a role in various functions, including the digestion and fermentation In particular, mast cells are frequently found around of cellulose and the absorption of water, sodium, carbon blood vessels and nerves [7]. They contain basophilic, cyto-  İletişim (Correspondence)  +90 256 2122300  mustafayildiz17@yahoo.com 198 The Distribution and Heterogeneity ... plasmic granules, which have histamine, heparin and stained with toluidine blue (TB, pH 0.5) [19] or with alcian eosinophil chemotactic factors [8], and they can also blue-critical electrolyte concentration (AB-CEC) (pH 5.8, secrete numerous cytokines that induce lymphocyte 0.3 M MgCl2) and safranin O (SO, pH 1.0) in a combined functions [9]. Moreover, mast cells play an important role in method [20,21]. Finally, the sections were examined under a regulating the sensitivity and permeability of the gastro- light microscope (Leica DMLB) equipped with an image- intestinal system [10]. Consequently, the number of mast analysis system (Leica Q Win Standard), and appropriate cells increases with the presence of some diseases, such locations were photographed. as irritable bowel syndrome [11,12]. Cell Count and Statistical Analyses Mast cells are classified as either mucosal mast cells (MMCs) or connective-tissue mast cells (CTMCs), depending A subjective scoring system was used to determine on their locations, responses to applied fixative solutions mast-cell distribution in the TB- and AB-CEC/SO-stained and mediator compositions in rats [13,14]. Whereas MMCs are tissues. Six sections of each animal’s cecum were scored most commonly found in the lamina propria and epithelial with a value from zero to four [22,23]. Mast-cell populations in layers of mucosal surfaces [15,16], CTMCs are located in the the cecum’s tunica mucosa (lamina propria+submucosa), skin, tongue, intestinal serosa and lung parenchyma [17]. tunica muscularis and tunica serosa were determined. [23] Mucosal mast-cell granules contain chondroitin sulphate [18] Scores indicating the cecum’s mast-cell densities were and rat mast-cell protease-II (RMCP-II) [17]. They are sensitive assigned as follows: 0 = absent (-); 1 = weak (+); 2 = to formalin [13] and are stained with AB (+) [14]. CTMC moderate (++); 3 = strong (+++); 4 = very strong (++++). granules, in contrast, are rich in heparin [18], contain rat Differences in mast cell-density values based on the mast-cell protease-I (RMCP-I) [17], are resistant to formalin [13] various fixative solutions used were calculated using the and are stained with SO (+) [14]. SPSS 17.0 program package. Data were analysed using one-way analyses of variance (ANOVAs), and the source The present study sought to determine the distribution of the group’s differences was determined post hoc with a of mast cells and subtype cells using several fixative Duncan’s test [24]. Furthermore, mast-cell densities between solutions and staining methods to better understand their the tunica mucosa folds of cecum parts were compared functions in the cecum of quails. using paired t-tests [25]. Values are presented herein as mean ± standard error. Values for which P<0.05 (*), P<0.01 (**) MATERIAL and METHODS and P<0.001 (***) were considered statistically significant. In the present study, a sample of 21 six- to nine- RESULTS week-old adult quails (Coturnix coturnix japonica) was used. The quails were obtained from Adnan Menderes Mast-cell distributions and densities for the proximal, University’s Department of Laboratory Animals at Aydin, middle and distal parts of the studied cecum were stained Turkey. They were kept in a storeyed cage system and fed with TB or AB-CEC/SO and examined using various fixative and watered ad libitum under conventional conditions. solutions. Mast cells were observed in the cecum’s lamina All procedures were approved by the Adnan Menderes propria, submucosa, tunica muscularis and serosa (Fig. 1). University Ethics Committee (Decision No: B.30.2.A They were especially noticeable in the connective tissue DÜ.0.00.00.00/050.04/2010/40). of the villi surrounding the blood vessels and between the glands in the tunica mucosa, as well as in the peripheral Examination with Light Microscopy nerves; they were observed less frequently overall in the cecal tonsils (Fig. 2), and notably, they were most evident The quails were euthanized by decapitation, and when BLA, Carnoy’s and IFAA fixative solutions were used. samples of their cecum were removed. The right and left But they were very few when the NBF solution was used. portions of cecum were separated. Then, right portions of Therefore, the data could not be obtained from NBF fixed first and second seven animals’ cecum were divided into sections and they could not be shown in tables. three parts, the proximal, middle and distal cecum, Next, they were fixed in basic lead acetate (BLA) (n=7) and 10% Mast cells were stained metachromatically with TB, and neutral buffered formalin (NBF) (n=7). Additionally, both orthochromatically stained TB (+) cells were also detected right and left portions of third seven animals’ cecum were (Fig. 1). Metachromatic mast-cell densities were greater in divided into three parts, the proximal, middle and distal the tunica mucosa than in the cecum’s other tissue folds, cecum. Then, the parts of the right portion in Carnoy’s regardless of the fixative solution used. Otherwise, they and the parts of left portion in isotonic formaldehyde were most evident in the tunica muscularis and serosa acetic acid (IFAA) solutions were fixed (n=7). After routine when Carnoy’s fluid was used in conjunction with TB histologic processing, the tissues were embedded in stain. Of course, it was evident that metachromatic mast paraffin, and six serial sections, each 5 μm thick, were cell density was determined the most in tunica mucosa taken at 70 μm intervals. The histologic sections were then layers of the middle and distal cecum. Mast cell population 199 YILDIZ, AYDEMİR KUM, EREN Fig 1. The metachromatic mast cells are seen in submucosa with IFAA (A), in tunica muscularis with BLA (B), in tunica serosa with Carnoy (C) and the orthochromatic TB (+) cells in villus with Carnoy fixed cecum (D). TB staining method. Bar: 20 μm (A,B,C), 5 μm (D) Şekil 1. Submukozada IFAA (A), tunika muskulariste BLA (B), tunika serozada Carnoy (C) ile tespit edilmiş sekumda metakromatik ve villusta Carnoy (D) ile tespit edilmiş sekumda ortokromatik TB (+) mast hücreleri görülmektedir. TB boyama metodu. Bar: 20 μm (A,B,C), 5 μm (D) Fig 2. The AB-CEC (+) / SO (-) mast cells are seen in villus with IFAA (A), between glands with BLA (B), in lymphatic nodule of cecal tonsil with Carnoy (C) and in peripheral nerve with NBF fixed cecum (D). AB-CEC/SO staining method. Bar: 20 μm Şekil 2. Villus IFAA (A), bezler ara- sında BLA (B), sekal tonsilin lenfatik nodülünde Carnoy (C) ve perifer sinirde NBF (D) ile tespit edilmiş sekumda AB-CEC (+) / SO (-) mast hücreleri görülmektedir. AB-CEC/ SO boyama metodu. Bar: 20 μm was shown in highest  ratios in all layers of Carnoy fixed The cecum’s mast cells were AB-CEC (+) and SO (-) cecum parts within TB-stained sections (P<0.05, P<0.01 reactive when the AB-CEC/SO staining method was used and P<0.001). Yet, while the mast-cell densities were (Fig. 2). That said, mast-cell densities were greater in the significantly lower in the tunica mucosa of the proximal tunica mucosa than they were in other folds fixed with regions of cecum fixed with Carnoy’s and IFAA fixatives IFAA and BLA solutions. Additionally, when Carnoy’s fluid than they were at the most rates in the middle and distal was used AB-CEC (+)/SO (-) mast cells were more evident regions of TB-stained cecum sections. All mast cell-density in the tunica muscularis and serosa of the tested cecum’s values from the presently described experiment are proximal and distal sections; thus, it was concluded that presented in Table 1. mast-cell populations increased in the presence of IFAA 200 The Distribution and Heterogeneity ... Table 1. The density values of metachromatic mast cells in proximal, middle and distal parts of cecum Tablo 1. Sekumun proksimal, orta ve distal bölümlerinde metakromatik mast hücrelerinin yoğunluk değerleri TB Proximal Middle Distal n Fixatives TM TMs TS TM TMs TS TM TMs TS IFAA 7 0.45±0.07B,b 0.23±0.05c 0.29±0.05b 1.52±0.10A,a 0.54±0.08b 0.09±0.04b 1.52±0.14A,a 0.45±0.07b 0.14±0.05b BLA 7 1.02±0.15a 0.54±0.09b 0.26±0.06b 1.11±0.09b 0.50±0.08b 0.16±0.05b 1.16±0.07b 0.57±0.09b 0.21±0.06b CARNOY 7 1.12±0.12B,a 0.87±0.11a 0.91±0.10a 1.70±0.10A,a 0.81±0.07a 0.65±0.09a 1.76±0.12A,a 1.00±0.09a 1.07±0.09a P *** *** *** *** * *** ** *** *** a,b,c Different superscripts in the same column indicate the significant difference. A,B Different superscripts in the same row indicate the significant difference. NS: Non-significant, * P<0,05, ** P<0,01, *** P<0,001, TB: Toluidine blue, IFAA: Isotonic formaldehyde acetic acid, BLA: Basic lead acetate, TM: Tunica mucosa, TMs: Tunica muscularis, TS: Tunica serosa Table 2. The density values of AB-CEC (+) / SO (-) mast cells in proximal, middle and distal parts of cecum Tablo 2. Sekumun proksimal, orta ve distal bölümlerinde AB-CEC (+) / SO (-) mast hücrelerinin yoğunluk değerleri AB-CEC/SO Proximal Middle Distal n Fixatives TM TMs TS TM TMs TS TM TMs TS IFAA 7 2.01±0.07A,C,a 0.44±0.06b 0.51±0.06b 2.16±0.10A,a 0.83±0.10 0.40±0.09b 1.85±0.11C 0.88±0.08a,b 0.45±0.08b BLA 7 2.09±0.11a 0.97±0.09a 0.57±0.08b 1.95±0.09a,b 0.79±0.08 0.62±0.08a,b 1.78±0.08 0.71±0.07b 0.54±0.08b CARNOY 7 0.85±0.11B,b 1.08±0.09a 1.10±0.10a 1.77±0.12A,b 0.93±0.06 0.77±0.11a 1.68±0.12A 1.08±0.10a 1.10±0.08a P *** *** *** * NS * NS * *** a,b Different superscripts in the same column indicate the significant difference. A,B,C Different superscripts in the same row indicate the significant difference, NS: Non-significant, * P<0.05, *** P<0.001, AB-CEC/SO: Alcian blue-critical electrolyte concentration/safranin O, IFAA: Isotonic formaldehyde acetic acid, BLA: Basic lead acetate, TM: Tunica mucosa, TMs: Tunica muscularis, TS: Tunica serosa and BLA solutions to the tunica mucosas of a cecum’s present study, orthochromatic TB (+) cells were observed proximal and middle portions when compared with the in the TB-stained sections. Mendonca et al.[28] report that introduction of Carnoy’s solution to the same (P<0.05, immature mast cells contain orthochromatic granules. P<0.001). It was also concluded that mast-cell density They also state that the granules become metachromatic is significantly lower for the tunica mucosa of a cecum when fully developed. Based on this information, it was proximal region to which Carnoy’s fixative has been concluded that the orthochromatically stained TB (+) cells introduced than it is for middle and distal cecum regions observed in the present study may be immature quail- stained with AB-CEC/SO. All values associate with mast- cecum mast cells. cell population are presented in Table 2. The effects of fixative solutions on various species’ mast-cell counts and distributions have been previously DISCUSSION reported. For example, it was found that BLA solution was better than Carnoy’s and IFAA solutions in fixing the mast Rodent mast cells are classified into two types, MMCs cells in turkey digestive systems [19]. Karaca and Yoruk [26] and CTMCs [13,14]. MMCs are stained with AB (+), and CTMCs have reported as well that the mast-cell distributions in are stained with SO (+) [14]. Uslu and Yoruk [19] state that MMCs chicken and quail digestive tracts are best determined stain blue and CTMCs stain red with a combined AB/SO with BLA and Carnoy’s solutions. Similarly, Carnoy’s staining method. And yet, the aforementioned researchers fixative solution is noted as the most effective fixative also report that three kinds of mast cells were found to for identifying mast cells in chicken intestinal mucosa [29], be AB (+), SO (+) and AB/SO (+) when AB/SO staining was and IFAA solution is seen as the most suitable fixative for introduced to some digestive-tract organs in chickens determining mast-cell density in the same. BLA solution, (gallus gallus domestica) [23], quails [26] and rats [27]. Moreover, meanwhile, has been shown comparatively superior to Harem and Liman [21] have demonstrated that rat and other fixatives in helping to identify the granule structures quail mast cells have varied glycosaminoglycan types with in the lower respiratory tracts and lungs of local ducks regards to both combined AB-CEC (pH 5.8, 0.3 M MgCl2) and geese [30]; as for identifying human MMCs, Strobel et and aldehyde fuchsin (AF) tissue-staining techniques. In al.[31] recommend using either Carnoy’s or BLA solution. the present study, the tested cecum mast cells were AB- Similarly, both Asti et al.[32] and Eren [33] have showed that CEC (+) and SO (-) reactive when the AB-CEC/SO staining more mast cells are identified in dog skin when the tissue method was used. For this reason, it was concluded that is fixed with IFAA solution than when it is fixed with 10% quail-cecum mast cells were MMCs. Furthermore, in the formaldehyde solution; it has been stated as well that 201 YILDIZ, AYDEMİR KUM, EREN a greater number of mast cells is found in Bouin-fixed state that lamina propria and submucosa have greater esophagus [34] and mast-cell density is greater in IFAA-fixed numbers of mast cells than do tunica muscularis and rat duodenum [27] and cow uterus [22]. On the other hand, serosa in quail cecum. In the present study, metachromatic while MMCs are commonly found in the lamina propria mast cell density was greater in the tunica mucosa than and epithelial layers of mucosal surfaces [15,16], CTMCs are it was in other folds of the cecum. Based on these results, found in skin, muscle and peritoneal cavity [35]. For its part, it can be asserted that mast cells are more often located the present study showed that mast-cell population was in the mucosal folds of quail cecum than they are in their in highest  ratios in all layers of Carnoy fixed cecum parts tunica muscularis and serosa. within TB-stained sections. Furthermore, it showed that AB-CEC (+)/SO (-) mast-cell density was greater when IFAA In conclusion, the distribution of mast cells for quail and BLA solutions were introduced into the tunica mucosa cecum was determined in the present study by applying of the tested proximal and middle cecum. In the study, it TB and AB-CEC/SO staining methods to all regions and showed that metachromatic mast cells are more evident folds of said cecum. Moreover, it was revealed that the in the tunica muscularis and serosa folds of all parts of type of fixative solution used when testing quail cecum the cecum when Carnoy’s fluid is used. Based on these tissue affects mast-cell distribution. results, the present study’s authors have concluded that REFERENCES different fixative solutions and staining methods affect the distribution of mast cells in quail cecum. Also, it can be 1. McLelland J: Anatomy of the avian cecum. J Exp Zool Suppl, 3, 2-9, said that Carnoy solution fixed the CTMCs, as well as IFAA 1989. DOI: 10.1002/jez.1402520503 and BLA solutions fixed the MMCs better. However, the 2. Clench MH: The avian cecum: Update and motility review. J Exp density values of mast cell were determined using  a semi- Zool, 283, 441-447, 1999. DOI:  10.1002/(SICI)1097-010X(19990301/01) 283:4/5<441::AID-JEZ13>3.0.CO;2-8 quantitative  scoring method in the study. For this reason, 3. Strong TR, Reimer PR, Braun EJ: Avian cecal microanatomy: A it is needed the studies that count of mast cells will be morphometric comparison of two species. J Exp Zool Suppl, 3, 10-20, 1989. revealed with stereological methods in order to improve DOI: 10.1002/jez.1402520504 the reliability of the study data. 4. Goldstein DL: Absorption by the cecum of wild birds: Is there interspecific variation? J Exp Zool Suppl, 3, 103-110, 1989. DOI:  10.1002/ The cecum contains diffuse and nodular lymphatic jez.1402520517 tissues [5], and these are located in the cecum’s proximal 5. Rezaian M, Hamedi S: Histological study of the caecal tonsil in the region [6]. Kiernan [36] has stated that mast-cell granules cecum of 4-6 months of age white leghorn chicks. Am J Anim Vet Sci, 2, containing heparin are stained with TB metachromatically 50-54, 2007. DOI: 10.3844/ajavsp.2007.50.54 and AB 8GX. The present study showed that mast-cell 6. Akter SH, Khan MZI, Jahan MR, Karim MR, Islam MR: Histo- morphological study of the lymphoid tissues of broiler chickens. Bangl density was significantly lower in the tunica mucosa of the J Vet Med, 4, 87-92, 2006. DOI: 10.3329/bjvm.v4i2.1289 cecum’s proximal region when Carnoy’s and IFAA fixatives 7. Metcalfe DD, Baram D, Mekori YA: Mast cells. Physiol Rev, 77, 1033- were used than it was in other cecum regions stained with 1079, 1997. TB, and these same circumstances were observed when 8. Parwaresch MR, Horny HP, Lennert K: Tissue mast cells in health Carnoy’s solution was used to fix cecum sections stained and disease. Pathol Res Pract, 179, 439-461, 1985. DOI: 10.1016/S0344- with AB-CEC/SO. It is therefore apparent that fewer mast 0338(85)80184-9 cells containing heparin are located in the tunica mucosa 9. Henz BM, Maurer M, Lippert U, Worm M, Babina M: Mast cells as initiators of immunity and host defense. Exp Dermatol, 10, 1-10, 2001. of the cecum’s proximal region if Carnoy’s and IFAA fixatives DOI: 10.1034/j.1600-0625.2001.100101.x are applied to it. Also, lymphatic tissues that are called as 10. Ramsay DB, Stephen S, Borum M, Voltaggio L, Doman DB: Mast cecal tonsils are located in the proximal part of the cecum. cells in gastrointestinal disease. Gastroenterol Hepatol, 6, 772-777, 2010. That’s why, fewer mast cells may be found in proximal 11. Guilarte M, Santos J, de Torres I, Alonso C, Vicario M, Ramos part of the cecum. Furthermore, in the present study mast L, Martínez C, Casellas F, Saperas E, Malagelada JR: Diarrhoea- cells were rarely observed with two-stain methods when predominant IBS patients show mast cell activation and hyperplasia in the jejunum. Gut, 56, 203-209, 2007. DOI: 10.1136/gut.2006.100594 NBF solution was used as a fixative. This is consistent 12. Weston AP, Biddle WL, Bhatia PS, Miner PB Jr: Terminal ileal with other studies showing that mast-cell counts are mucosal mast cells in irritable bowel syndrome. Dig Dis Sci, 38, 1590-1595, lower in NBF-fixed tissue than in tissues fixed with other 1993. DOI: 10.1007/BF01303164 solutions [29,31,34]. As with previous studies, the present 13. Enerbäck L: Mast cells in rat gastrointestinal mucosa. I. Effect of study shows that MMCs are sensitive to formalin. It may fixation. Acta Pathol Microbiol Scand, 66, 289-302, 1966. therefore be concluded that they are not sufficiently 14. Enerbäck L: Mast cells in rat gastrointestinal mucosa. 2. Dye-binding preserved in NBF solution. and metachromatic properties. Acta Pathol Microbiol Scand, 66, 303-312, 1966. Mast-cell densities vary in different poultry digestive- 15. Miller HR: Mucosal mast cells and the allergic response against tract folds. Uslu and Yoruk [19] report that mast-cell numbers nematode parasites. Vet Immunol Immunopathol, 54, 331-336, 1996. DOI: 10.1016/S0165-2427(96)05696-6 are highest in the submucosa, and they were similar in 16. Huntley JF, McGorum B, Newlands GF, Miller HR: Granulated lamina propria and tunica muscularis + tunica serosa of intraepithelial lymphocytes: their relationship to mucosal mast cells and turkey digestive tract. Additionally, Karaca and Yoruk [26] globule leucocytes in the rat. Immunology, 53, 525-535, 1984. 202 The Distribution and Heterogeneity ... 17. Gibson S, Miller HR: Mast cell subsets in the rat distinguished distribution and heterogeneity of mast cells of chicken’s and quail’s immunohistochemically by their content of serine proteinases. Immunology, digestive tract. Van Vet J, 15, 115-121, 2004. 58, 101-104, 1986. 27. Demirbag E, Cınar K, Kutlar MH, Eroglu G, Sari SM: Distribution 18. Pipkorn U, Karlsson G, Enerbäck L: Phenotypic expression of and heterogenity of mast cells in small intestine of rat (Rattus rattus). proteoglycan in mast cells of the human nasal mucosa. Histochem J, 20, SDU J Sci, 7, 92-99, 2012. 519-525, 1988. DOI: 10.1007/BF01002650 28. Mendonca VO, Vugman I, Jamur MC: Maturation of adult rat 19. Uslu S, Yoruk M: Morphological and histometrical studies on peritoneal and mesenteric mast cells. Cell Tissue Res, 243, 635-639, 1986. distribution and heterogeneity of mast cells in turkey digestive system. DOI: 10.1007/BF00218072 Van Vet J, 19, 47-51, 2008. 29. Fei ACY, Chi Lee YC: The fixation effects of mast cells in chicken 20. Scott JE, Dorling J: Differential staining of acid glycosaminoglycans intestinal mucosa. Bull Inst Zool Academia Sinica, 22, 119-122, 1983. (mucopolysaccharides) by Alcian blue in salt solutions. Histochemie, 5, 30. Uslu S, Yoruk M: Morfological and histometric studies on mast cell 221-233, 1965. distribution and heterogeneity, present in the lower respiratory tract 21. Harem MK, Liman N: Histochemical method for demonstrating quail and in the lung of local duck (Anas platyrhnchase) and goose (Anser mast cell types simultaneously. Biotech Histochem, 84, 275-282, 2009. DOI: anser). Kafkas Univ Vet Fak Derg, 19, 475-482, 2013. DOI: 10.9775/ 10.3109/10520290902991394 kvfd.2012.8064 22. Eren U, Asti RN, Kurtdede N, Sandikci M, Sur E: The histological and 31. Strobel S, Miller HR, Ferguson A: Human intestinal mucosal mast histochemical properties of the mast cells and the mast cell heterogeneity cells: evaluation of fixation and staining techniques. J Clin Pathol, 34, 851- in the cow uterus. Tr J Vet Anim Sci, 23, 193-201, 1999. 858, 1981. DOI: 10.1136/jcp.34.8.851 23. Aksoy A, Cinar K: The ontogeny, distribution and histochemistry 32. Asti RN, Kurtdede A, Kurtdede N, Ergun E, Guzel M: Mast cells in of mast cells in the proventriculus of gallus gallus domestica in pre- the dog skin: Distribution, density, heterogeneity and influence of fixation and postnatal periods. Van Vet J, 19, 25-29, 2008. techniques. Ankara Univ Vet Fak Derg, 52, 7-12, 2005. DOI:  10.1501/ Vetfak_0000000022  24. Park JY, Hong SM, Klimstra DS, Goggins MG, Maitra A, Hruban RH: Pdx1 expression in pancreatic precursor lesions and neoplasms. 33. Eren U: Mast cells in the skin of dog. Ankara Univ Vet Fak Derg, 47, 167- Appl Immunohistochem Mol Morphol, 19, 444-449, 2011. DOI: 10.1097/ 175, 2000. DOI: 10.1501/Vetfak_0000000500 PAI.0b013e318206d958 34. Kelek S, Cimenoglu N, Cinar K: The determination of mast cell 25. Grzybowska KK, Letourneau R, Kempuraj D, Donelan J, Poplawski density with different fixatives in the esophagus of the goose (Anser S, Boucher W, Athanassiou A, Theoharides TC: IL-1 Induces vesicular anser). SDU Fen Bil Enst Derg, 15, 102-104, 2011. secretion of IL-6 without degranulation from human mast cells. J Immunol, 35. Enerback L: The gut mucosal mast cell. Monogr Allergy, 17, 222-232, 1981. 171, 4830-4836, 2003. DOI: 10.4049/jimmunol.171.9.4830 36. Kiernan JA: A comparative survey of the mast cells of the mammalian 26. Karaca T, Yoruk M: A morphological and histometrical study on brain. J Anat, 121, 303-311, 1976. Kafkas Univ Vet Fak Derg KafKas Universitesi veteriner faKUltesi Dergisi 22 (2): 203-214, 2016 JoUrnal Home-Page: http://vetdergi.kafkas.edu.tr Research Article DOI: 10.9775/kvfd.2015.14135 online sUbmission: http://vetdergikafkas.org Thymoquinone, the Main Constituent of Nigella sativa, Could Impact on Adenosine A2 Receptors in Ovalbumin-sensitized Guinea Pigs Zahra MIRZAMOHAMMADI 1 Behzad BARADARAN 2 Dariush SHANEHBANDI 2 Rana KEYHANMANESH 3 Amir Ali SHAHBAZFAR 4 Laleh PEJMAN 1 1 Department of Physiology, Faculty of Medicine, Tabriz University of Medical Sciences, Tabriz, IRAN 2 Immunology Research Center, Tabriz University of Medical Sciences, Tabriz, IRAN 3 Drug Applied Research Center, Tabriz University of Medical Sciences, Tabriz, IRAN 4 Department of Pathology, Faculty of Veterinary Medicine, University of Tabriz, Tabriz, IRAN Article Code: KVFD-2015-14135 Received: 31.07.2015 Accepted: 23.12.2015 Published Online: 14.01.2016 Abstract Thymoquinone has demonstrated anti-asthmatic effects in many studies but its exact mechanism is not yet fully known. This investigation aims to demonstrate its prophylactic effect in the presence of selective A2A and A2B adenosine receptors (AR) antagonist; MRS1706 and ZM241365, in sensitized guinea pigs. The gene expression of A2 AR in blood lymphocytes and lung tissue, lung pathological changes and blood cytokines were evaluated in seven groups. The experiments in blood lymphocytes and lung tissue showed that thymoquinone could increase A2AAR mRNA expression and decrease A2B AR mRNA expression significantly (P<0.001 to P<0.05); however sensitization had opposite effects. Administration of A2A receptor antagonist attenuated inflammation and A2B receptor antagonist could prevent asthma-induced inflammatory changes. Moreover, the administration of thymoquinone and A2Areceptor antagonist together relieved inflammation. Gene expression of A2B receptor showed that thymoquinone administration has more influence on blood lymphocytes while administration of the selective A2B receptor antagonist was more effective in lung tissue. The results showed some of the therapeutic effects of thymoquinone in reducing asthma symptoms might be partially mediated through A2 adenosine receptors. Keywords: Asthma, Adenosine, MRS1706, ZM241365, Gene expression Nigella Sativa’nın Biyoaktif Komponenti Olan Timokinon Ovalbuminle Uyarılmış Ginedomuzlarında Adenozin A2 Reseptörlerini Etkileyebilir Özet Timokinonun birçok çalışmada anti-astmatik etkileri olduğu gösterilmesine rağmen tam mekanizması tamamıyla anlaşılamamıştır. Bu çalışma A2A ve A2B adenozin reseptör (AR) antagonistlerinin (MRS1706 ve ZM241365) mevcudiyetinde timokinonun uyarılmış ginedomuzlarındaki proflaktik etkisini araştırmak amacıyla yapılmıştır. Çalışmada toplam yedi grupta kan lenfositleri ve akciğer dokusunda A2 AR gen ekspresyonları, akciğerdeki patolojik değişiklikler ve kan sitokinleri değerlendirildi. Kan lenfositleri ve akciğer dokusunda yapılan incelemeler timokinonun A2AAR mRNA ekspresyonunu arttırdığını ve A2B AR mRNA ekspresyonunu ise anlamlı oranda azalttığını, ancak uyarılmanın ters etki yaptığını ortaya koydu (P<0.001 to P<0.05). A2A reseptör antagonisti yangıyı azaltırken ve A2B reseptör antagonisti astma tarafından oluşturulan yangısal değişikliklere karşı koruyucu etki gösterebilir. Ayrıca, timokinon ve A2A reseptör antagonistinin birlikte uygulanması yangıyı hafifletti. A2B reseptör gen ekspresyonu timokinon uygulamasının kan lenfositleri üzerinde daha etkili olduğunu A2B reseptör antagonistinin ise akciğer dokusunda daha etkili olduğunu gösterdi. Elde edilen sonuçlar astma semptomlarının azaltılmasında timokinon uygulamasının terapötik etkilerinin kısmen A2 adenozin reseptörleri yoluyla oluştuğunu göstermiştir. Anahtar sözcükler: Astma, Adenozin, MRS1706, ZM241365, Gen ekspresyonu  İletişim (Correspondence)  +98 413 3364664  keyhanmaneshr@tbzmed.ac.ir; rkeyhanmanesh@gmail.com 204 Thymoquinone, the Main ... INTRODUCTION presence of selective A2A and A2B adenosine receptor antagonists; ZM241365 and MRS1706, in asthmatic guinea Asthma is a chronic and acute respiratory disease of the pigs. In addition, blood IL-4 and IFN-γ level and lung airways [1] which has been identified by various properties pathological changes were assessed in different groups. such as the increased responsiveness of airways to physical and chemical stimuli [2]. In asthma, the responses of the MATERIAL and METHODS immune system and related cells including T lymphocytes are influenced. Asthma is accompanied by the increase Animal Sensitization and Animal Groups: Seventy in the immune system of Th2 cells and a decrease in the male adult Dunkin-Hartley guinea pigs (400-700 g) were immune response of Th1 cells. Th2 cells are the regulators used throughout the study. After transportation, they were of pre-inflammatory responses and Th1 cells directly or allowed to acclimatize to the new situation for ten days. indirectly inhibit Th2 cells [3,4]. Therefore, the increased level They were kept in individual cages at 22±2°C on a 12-h light/ of IL-4 (cell markers of Th2) and decreased level of IFN-γ dark cycle and allowed free access to standard chow and (cell markers of Th1) can be seen in this disease [5,6]. water. Then the animals were randomly divided into seven groups; control group (C), sensitized group with ovalbumin Other regulating factors which are propounded in the (S), sensitized group pretreated with thymoquinone (3 inflammation are adenosine and adenosine receptors. mg/kg i.p.; S+TQ) [23], sensitized group pretreated with Adenosine is a purine nucleoside of adenine that mediates selective A2A adenosine receptor antagonist (ZM241385, 3 the various physiological functions through four trans- mg/kg i.p.; S+Anta A ) [24]2A , sensitized group pretreated with membrane receptors; A , A , A and A [7]1 2A 2B 3 . In asthmatic selective A2B adenosine receptor antagonist (MRS1706, 3 patients, the level of adenosine in liquid bronchoalveolar mg/kg i.p.; S+Anta A ) [9]2B , sensitized group pretreated with lavage is noticeably more than the healthy people [8]. thymoquinone and A2A adenosine receptor antagonist Moreover, inhaled adenosine causes bronchial contraction in (S+TQ+Anta A2A) and sensitized group pretreated with asthmatic patients but in healthy people it does not thymoquinone and A2B adenosine receptor antagonist cause any contraction [9]. In fact, adenosine receptors act (S+TQ+Anta A2B). Thymoquinone, ZM241385 and MRS1706 as sensor and extracellular adenosine acts as a reporter [10]. with 3 mg/kg dose were injected intraperitoneally on The stimulation of adenosine A2A receptor inhibits the day 10 of induction protocol. All groups were housed in release of inflammatory mediators [11] and also prevents climate-controlled animal quarters and were given water the activation of T cells [12] and inhibits the mobilization of and food ad libitum, while a12-h on/12-h off light cycle inflammatory cells in the airways. The stimulation of A2B was maintained. receptor in human beings activates the mast cells [13], and as a result, increases the release of IL-8 [14]. The inhibition Sensitization of animals to ovalbumin (OA) was of A2B receptors can have helpful therapeutic effects on performed using the method used in our previous study [25]. asthma [15] and lead to the decrease of bronchospasm in Briefly, guinea pigs were sensitized to ovalbumin (Grade II response to such stimuli as AMP [16]. Sigma Chemical Ltd., UK) dissolved in saline by injecting 100 mg i.p. and 100 mg s.c. on the first day and a further 10 Nowadays, a lot of medicines are used for treating mg i.p. on the 8th day. From day 14, sensitized animals were asthma, but the long-term use of them results in therapeutic exposed to an aerosol of 4% ovalbumin for 18±1 days, resistance and will have some undesirable side effects. 4 min daily. The aerosol was administered in a closed Therefore, in recent years, the researchers have tried to chamber, dimensions 30 × 20 × 20 cm. Control animals find new medicines with high effectiveness and fewer were treated similarly but saline was used instead of side effects. One of these approaches is using herbs. Many ovalbumin solution. The study was approved by the ethical studies showed that Nigella sativa had anti-inflammatory committee of the Tabriz University of Medical Sciences and therapeutic effects [17-20]. Moreover, our previous (No: TBZMED.REC.1394.862). studies demonstrated that the extract of Nigella sativa and its main constituent, thymoquinone, had preventive Evaluation of the Gene Expression of A2 Receptors effects on asthma and precluded its inflammatory and in Blood Lymphocytes and Lung Tissue: One day after pathological changes [5,6,21,22]. the induction period, the animals were killed by cervical dislocation and 5 ml blood sample and approximately, The exact mechanism of anti-asthmatic effect of 100 µg of left lung tissue were obtained immediately. thymoquinone is not known yet and the adjustment of At first, blood RBCs were eliminated by RBC lysis buffer Th1/Th2 balance has been suggested as one of the possible containing 9 g NH4Cl, 1g KHCO3 and 0.2 ml of 0.5M EDTA mechanisms for thymoquinone. In light of this, and in order per liter. The pH was adjusted to 7.3. Then TRIzol reagent to find out the intracellular mechanisms of thymoquinone, was used for RNA extraction. Lung specimens were also this investigation was proposed to demonstrate its pro- grinded and subjected to total RNA extraction by 1 ml phylactic effect on gene expression of A2 adenosine of TRIzol reagent (life technologies Co) according to the receptors in blood lymphocytes and lung tissue in the manufacturer’s recommendations. After that, cDNA was 205 MIRZAMOHAMMADI, BARADARAN, SHANEHBANDI KEYHANMANESH, SHAHBAZFAR, PEJMAN synthesized by Revert Aid First Strand cDNA Synthesis data of five pretreated groups were compared with Kit (Thermo Scientific Co) using 5 µg of total RNA. The sensitized guinea pigs using one-way analysis of variance effect of thymoquinone on the gene expression of A2 (ANOVA) with Tukey-Kramer. The data of four pretreated adenosine receptors was investigated with RT-PCR. groups were compared with S+TQ group using one-way Specific primers were designed for control and receptor analysis of variance (ANOVA) with Tukey-Kramer. genes. A2B primers were designed by OLIGO (version 5.0). The sequences were A2A F: 5′-GCA GAA CGT CAC CAA RESULTS CTA CTT-3′, A2A R: 5′-CAG GTC ACC AAG CCA TTG TA-3′, A2B F: 5′-CTT TGG CAT TGG ATT GAC TC-3′ and A2B R: 5′- Analysis of A2A Adenosine Receptor Gene Expression CCA GCA TGA TGA GCA GTG G-3′. b-actin was employed in Blood Lymphocytes: Compared to the control group, as a housekeeping gene to normalize expression levels of the gene expression of A2A adenosine receptor in target genes. Primer sequences for b-actin were: b-actin S and S+Anta A2A groups decreased significantly (P<0.05 F: 5′- TCC CTG GAG AAG AGC TAC G-3′ and b-actin R: 5′- GTA and percentage changes = -43% for S, P<0.01 and per- GTT TCG TGG ATG CCA CA-3′. centage changes = -62% for S+Anta A2A) and in S+TQ The cycling included denaturation at 94°C for 3 min group increased significantly (P<0.001 and percentage followed by 30 cycles of 94°C for 30 s, 58°C for 40 s and changes = 120%, Fig. 1). There was a significant increase 72°C for 30 s and a final extension at 72°C for 10 min. PCR in A2A adenosine receptor gene expression in S+TQ and products were electrophorized utilizing 1.5% agarose gel S+TQ+Anta A2A groups compared to the sensitized group and appropriate amount of safe stain (Cinnagen Co,Islamic (P<0.001 to P<0.01). Percentage changes in these groups republic of Iran) and were visualized by gel documentation are as follows: S+TQ=288% and S+TQ+AntaA2A=91% (Fig. 2). apparatus. 100 bp DNA ladder (SM0311, Fermentas Co.) was The gene expression of A2A adenosine receptor in S+ used as size marker. Finally the electrophoresed gene was photographed by document gene device and the intensity of bands was investigated through Image J software (National Institutes of Health, Bethesda, Maryland, USA) and normalized to its actin loading control. Evaluations of Blood IL-4 and IFN-γ Levels: A total of 5 ml peripheral blood was obtained immediately after sacrificing the animals and placed at room temperature for 1 h. The samples were then centrifuged at 3500×g at 4°C for 10 min. The supernatant was collected and immediately put at -70°C until analyzed. Finally, blood IL-4 and IFN-γ were measured using the enzyme-linked immunosorbent assay (ELISA) Sandwich method [6]. Pathological Evaluation: Lungs and trachea were kept in 10% (v/v) buffered formalin. A week later tissues were dried by a range of ethanol concentrations (70%- 100%) through Passage method. The samples were saturated in paraffin and put into blocks after being cleared by xylol. Then 4 micron-width slices were prepared using microtome. Finally, the specimens were stained by hematoxylin-eosin (H&E) and evaluated under a light microscope. The pathological changes in the lungs of all groups included vascular and airways smooth muscle hypertrophy and hyperplasia, the presence of mucosal plug, respiratory epithelial denudation, inflammatory infiltration and emphysema [5,21]. The pathological changes were scored Fig 1. A2A adenosine receptor gene expression analysis using RT-PCR according to previous studies as follows: 0: no pathologic in blood lymphocytes in the control (C), sensitized (S), S pretreated changes, 1: patchy changes, 2: local changes, 3: scattered with thymoquinone (S+TQ), S pretreated with A2A adenosine receptor antagonist (S+Anta A2A) and S pretreated with thymoquinone and A changes and 4: severe changes. 2Aadenosine receptor antagonist (S+TQ+Anta A2A) guinea pigs Statistical Analysis: All the results were considered Şekil 1. RT-PCR ile kan lenfositlerinde A2A adenozin reseptör gen ekspresyonu analizi; Kontrol (C), uyarılmış (S), timokinon verilmiş S as mean ± SEM. The data of six sensitized groups were (S+TQ), A2A adenozin reseptör antagonisti verilmiş S (S+Anta A2A) compared with controls using one-way analysis of variance ve timokinon ile birlikte A2A adenozin reseptör antagonisti verilmiş (ANOVA) with Tukey-Kramer post-test. Furthermore, the (S+TQ+Anta A2A) ginedonumuzu 206 Thymoquinone, the Main ... Fig 2. Individual values and mean±SEM (big symbols with bars) of the gene expression of A2A adenosine receptor in blood lymphocytes of control (C), sensitized (S), sensitized pretreated with thymoquinone (S+TQ), sensitized pretreated with selective A2A antagonist (S+Anta A2A), sensitized pretreated with selective A2B antagonist (S+Anta A2B), sensitized pretreated with selective A2A antagonist and thymoquinone (S+Anta A2A+TQ) and sensitized pretreated with selective A2B antagonist and thymoquinone (S+Anta A2B+TQ) groups (for each group, n=6). Statistical differences between control and different groups: + P<0.05, ++ P<0.01, +++ P<0.001. Statistical differences between pretreated groups vs sensitized group: * P<0.05, ** P<0.01, *** P<0.001 Şekil 2. Kan lenfositlerinde A2A adenozin reseptör gen ekspresyonun bireysel değerleri ve ortalama ± SEM (Barlı büyük semboller). Kontrol (C), uyarılmış (S), timokinon verilmiş ve uyarılmış (S+TQ), A2A antagonisti Fig 3. A2A adenosine receptor gene expression analysis using RT- verilmiş ve uyarılmış (S+Anta A2A), A2B antagonisti verilmiş ve uyarılmış PCR in lung tissue in the control (C), sensitized (S), S pretreated with (S+Anta A2B), timokinon ile birlikte A2A antagonisti verilmiş ve uyarılmış thymoquinone (S+TQ), S pretreated with A2A adenosine receptor (S+Anta A2A+TQ), timokinon ile birlikte A2B antagonisti verilmiş ve antagonist (S+Anta A2A) and S pretreated with thymoquinone and A2A uyarılmış (S+Anta A2B+TQ) ginedonumuzu (Her grupta n=6). Kontrol ve adenosine receptor antagonist (S+TQ+Anta A2A) guinea pigs diğer gruplar arasındaki istatistiksel farklar: + P<0.05, ++ P<0.01, +++ Şekil 3. RT-PCR ile akciğer dokusunda A2A adenozin reseptör gen P<0.001. Madde uygulanmış ve uyarılmış gruplar arasındaki istatistiksel ekspresyonu analizi; Kontrol (C), uyarılmış (S), timokinon verilmiş S farklar: * P<0.05, ** P<0.01, *** P<0.001 (S+TQ), A2A adenozin reseptör antagonisti verilmiş S (S+Anta A2A) ve timokinon ile birlikte A2A adenozin reseptör antagonisti verilmiş Anta A2A and S+TQ+Anta A2A groups decreased significantly (S+TQ+Anta A2A) ginedonumuzu compared to thymoquinone pretreated group (P<0.001 and percentage changes = -82% for S+Anta A2A, P<0.001, receptor in S+TQ+Anta A2A group was significantly percentage changes = -50% for S+TQ+Anta A2A). The gene more than S+Anta A2A group (P<0.01, percentage changes expression of A2A adenosine receptor in S+TQ+Anta A2A = 188%). group was significantly higher than in S+Anta A2A group (P<0.01, percentage changes= 188%). Analysis of A2B Adenosine Receptor Gene Expression in Blood Lymphocytes: Compared to the control group, Analysis of A2A Adenosine Receptor Gene Expression the gene expression of A2B adenosine receptor in S and in Lung Tissue: In comparison to the control group, the gene S+TQ groups increased significantly (P<0.001 and expression of A2A adenosine receptor in S and S+Anta A2A percentage changes = 632% for S, P<0.01 and percentage groups decreased significantly (P<0.05 and percentage changes = 256% for S+TQ, Fig. 5). All pretreated groups changes = -36% for S, P<0.01 and percentage changes = showed a significant decrease in A2B adenosine receptor -61%, Fig. 3). There was significant increase in A2A adenosine gene expression compared with sensitized group (P<0.001 receptor gene expression in S+TQ and S+TQ+Anta A2A to P<0.01). Percentage changes in these groups are as groups compared to group S (P<0.01 and percentage follows: S+TQ = -51%, S+Anta A2B = -63% and S+TQ+Anta changes = 129% for S+TQ, P<0.05 and percentage changes A2B = -191%, Fig. 6). = 76% for S+TQ+Anta A2A, Fig. 4). The gene expression of A2B adenosine receptor in blood A2A adenosine receptor gene expression in S+Anta of S+TQ+Anta A2B group decreased significantly compared A2A group was significantly lower than the S group to thymoquinone pretreated group and S+Anta A2B group (P<0.05, percentage changes= -39%). The gene expression (P<0.001, Table 1). of A2A adenosine receptor in lung tissue of S+Anta A2A group decreased compared to thymoquinone pretreated Analysis of A2B Adenosine Receptor Gene Expression group (P<0.001). The gene expression of A2A adenosine in Lung Tissue: As compared with control group, the 207 MIRZAMOHAMMADI, BARADARAN, SHANEHBANDI KEYHANMANESH, SHAHBAZFAR, PEJMAN gene expression of A2B adenosine receptor in S and The gene expression of A2B adenosine receptor in the S+TQ groups increased significantly (P<0.001 and per- lung tissue of S+Anta A2B and S+TQ+Anta A2B groups centage changes = 291% for S, P<0.01 and percentage decreased compared to thymoquinone pretreated group changes = 171% for S+TQ, Fig. 7). With regard to the (P<0.001, percentage changes = -68% for S+Anta A2B sensitized group, the gene expression of A2B adenosine and percentage changes = -70% for S+TQ+Anta A2B). receptor in lung tissue of all pretreated groups decreased In the lung tissue of S+TQ+Anta A2B group, the gene significantly (P<0.001 to P<0.05, Fig. 8). expression of A2B adenosine receptor was significantly lower than S+Anta A2B group (P<0.01, percentage changes = -5.50%, Table 1). Pathology: With regard to this scoring, all pathological changes in the S, S+Anta A2A and S+TQ+Anta A2A groups, including the vascular membrane hyperplasia, airway membrane hyperplasia, the presence of mucosal plug, respiratory epithelial denudation, cellular infiltration and emphysema were significantly higher than those in the C group (P<0.05 for all cases). Moreover, the presence of mucosal plug, respiratory epithelial denudation and emphy- sema in S+TQ and S+Anta A2B groups were significantly higher than those in the C group (P<0.05, Fig. 9a-g). All pathological changes in S+TQ, S+Anta A2B and S+TQ+ Anta A2B groups (except inflammatory infiltration Fig 4. Individual values and mean±SEM (big symbols with bars) of the in S+Anta A2B), and the presence of mucosal plug in gene expression of A2A adenosine receptor in lung tissue of control S+TQ+Anta A2A group were significantly decreased in (C), sensitized (S), sensitized pretreated with thymoquinone (S+TQ), comparison with the sensitized group (P<0.05). However, sensitized pretreated with selective A2A antagonist (S+Anta A2A) and sensitized pretreated with selective A2A antagonist and thymoquinone there were still significant variations in presence of mucosal (S+Anta A2A+TQ) groups (for each group, n=6). Statistical differences plug, respiratory epithelial denudation and emphysema between control and different groups: + P<0.05, ++ P<0.01. Statistical between the C group and S+TQ group (P< 0.05, Table 2). differences between pretreated groups vs sensitized group: * P<0.05, ** P<0.01 All criteria in S+Anta A2A group, and airway membrane Şekil 4. Akciğer dokusunda A2A adenozin reseptör gen ekspresyonun hyperplasia, the presence of mucosal plug and cellular bireysel değerleri ve ortalama ± SEM (Barlı büyük semboller). Kontrol (C), uyarılmış (S), timokinon verilmiş ve uyarılmış (S+TQ), A antagonisti infiltration in S+Anta A2B group were significantly higher 2A verilmiş ve uyarılmış (S+Anta A2A), A2B antagonisti verilmiş ve uyarılmış than S+TQ group (P<0.001 to P<0.05). There were no (S+Anta A2B), timokinon ile birlikte A2A antagonisti verilmiş ve uyarılmış differences in the pathological changes between S+TQ+ (S+Anta A2A+TQ), timokinon ile birlikte A2B antagonisti verilmiş ve Anta A2A and S+TQ+Anta A2B groups and the S+TQ group. uyarılmış (S+Anta A2B+TQ) ginedonumuzu (Her grupta n=6). Kontrol ve diğer gruplar arasındaki istatistiksel farklar: + P<0.05, ++ P<0.01. Madde There was not any significant differences between S+Anta uygulanmış ve uyarılmış gruplar arasındaki istatistiksel farklar: * P<0.05, A2A and S+TQ+Anta A2A groups and between S+Anta A2B ** P<0.01 and the S+TQ+Anta A2B group (Table 2). Table 1. The mean value of the gene expression of A2B adenosine receptor in blood lymphocyte and lung tissue and blood cytokines (IL-4 and IFN-g) in control (C), sensitized (S), sensitized pretreated with thymoquinone (S+TQ), sensitized pretreated with selective A2A antagonist (S+Anta A2A), sensitized pretreated with selective A2B antagonist (S+Anta A2B), sensitized pretreated with selective A2A antagonist and thymoquinone (S+Anta A2A+TQ) and sensitized pretreated with selective A2B antagonist and thymoquinone (S+Anta A2B+TQ) groups(for each group, n = 8) Tablo 1. Kan lenfosit ve akciğer dokusu A2B adenozin reseptör gen ekspresyonu ile kan sitokinlerinin ortalama değerleri. Kontrol (C), uyarılmış (S), timokinon verilmiş ve uyarılmış (S+TQ), A2A antagonisti verilmiş ve uyarılmış (S+Anta A2A), A2B antagonisti verilmiş ve uyarılmış (S+Anta A2B), A2A antagonisti ve timokinon verilmiş ve uyarılmış (S+Anta A2A+TQ) ve A2B antagonisti ve timokinon verilmiş ve uyarılmış (S+Anta A2B+TQ) (Her grupta n=8) Parameter C S S+TQ S+Anta A2A S+Anta A2B S+TQ+Anta A2A S+TQ+Anta A2B The gene expression of A2B adenosine 0.54±0.23 3.93±0.51 1.91±0.16 0.63±0.15 1.41±0.34 1.82±0.20 0.34±0.13receptor in blood lymphocyte +++ ** +++ ### The gene expression of A2B adenosine 0.58±0.05 0.51±0.08 1.68±0.24 0.48±0.14 receptor in lung tissue 0.59±0.18 2.32±0.27 1.61±0.13 +++ +++ ** +++ ## Blood IL-4 level 39.78±2.01 47.41±1.98 43.88±1.70 49.48±2.74 45.20±2.15 46.24±1.38 39.98±0.82# Blood IFN-gamma level 104.97±5.93 117.37±2.71 124.93±2.31 101.14±3.24 120.03±2.95 107.87±2.04+++ +++ 126.04±2.81 Statistical differences between pretreated groups vs S+TQ group: +++; P<0.001; Statistical differences between S+TQ+Anta A2A group vsS+Anta A2A group: ** P<0.01; Statistical differences between S+TQ+Anta A2B group vsS+Anta A2B group: #; P<0.05; ##; P<0.01, ###; P<0.001 208 Thymoquinone, the Main ... Table 2. The mean value of different pathological changes in control (C), sensitized (S), sensitized pretreated with thymoquinone (S+TQ), sensitized pretreated with selective A2A antagonist (S+Anta A2A), sensitized pretreated with selective A2B antagonist (S+Anta A2B), sensitized pretreated with selective A2A antagonist and thymoquinone (S+Anta A2A+TQ) and sensitized pretreated with selective A2B antagonist and thymoquinone (S+Anta A2B+TQ) groups (for each group, n = 8 Tablo 2. Değişik patolojik değişimlerim ortalama değeri. Kontrol (C), uyarılmış (S), timokinon verilmiş ve uyarılmış (S+TQ), A2A antagonisti verilmiş ve uyarılmış (S+Anta A2A), A2B antagonisti verilmiş ve uyarılmış (S+Anta A2B), A2A antagonisti ve timokinon verilmiş ve uyarılmış (S+Anta A2A+TQ) ve A2B antagonisti ve timokinon verilmiş ve uyarılmış (S+Anta A2B+TQ) (Her grupta n=8) Parameter C S S+TQ S+Anta A2A S+Anta A2B S+TQ+Anta A2A S+TQ+Anta A2B Vascular smooth muscle hypertrophy 0.33±0.21 3±0.3 1.33±0.30 2.90±0.28 1.42±0.48 2.29±0.42 0.86±0.34and hyperplasia +++ ** +++ ## * + ** Airways smooth muscle hypertrophy 0.17±0.16 2.54±0.28 0.83±0.24 2.54±0.31 0.86±0.34 2.29±0.42 0.71±0.29and hyperplasia +++ *** +++ ### ** ++ # ** Presence of mucosal plug 0±0 2.72±0.14 0.67±0.19 2.27±0.23 1.14±0.34 1.71±0.29 0.29±0.18+++ *** +++ ### + *** +++ * # *** Respiratory epithelial denudation 0.17±0.16 2.18±0.23 0.83±0.20 2.45±0.21 0.86±0.26 1.71±0.29 0.29±0.18+++ *** +++ ### ** ++ *** Inflammatory infiltration 0±0 1.55±0.20 0.41±0.19 2.18±0.22 0.71±0.35 1.85±0.34 0.57±0.30++ ** +++ ### +++ ## 2±0.27 0.92±0.19 2.18±0.23 1.43±0.30 1.77±0.29 0.71±0.29Emphysema 0.17±0.16 +++ * +++ ## ++ * Statistical differences between groups vs C group: ++; P<0.01, +++; P<0.001; Statistical differences between pretreated groups vs S group: * P<0.05, ** P<0.01, *** P<0.001; Statistical differences between pretreated groups vs S+TQ group: #; P<0.05, ##; P<0.01, ###; P<0.001 Fig 6. Individual values and mean±SEM (big symbols with bars) of the gene expression of A2B adenosine receptor in blood lymphocytes of control (C), sensitized (S), sensitized pretreated with thymoquinone (S+TQ), sensitized pretreated with selective A2B antagonist (S+Anta A2B) and sensitized pretreated with selective A2B antagonist and thymoquinone (S+Anta A2B+TQ) groups (for each group, n=6). Statistical differences between control and different groups: ++ P<0.01, +++ P<0.001, Statistical differences between pretreated groups vs sensitized group: * P<0.05, ** P<0.01, *** P<0.001 Fig 5. A2B adenosine receptor gene expression analysis using RT-PCR Şekil 6. Kan lenfositlerinde A2B adenozin reseptör gen ekspresyonun in blood lymphocytes in the control (C), sensitized (S), S pretreated bireysel değerleri ve ortalama ± SEM (Barlı büyük semboller). with thymoquinone (S+TQ), S pretreated with A2B adenosine receptor Kontrol (C), uyarılmış (S), timokinon verilmiş ve uyarılmış (S+TQ), A2B antagonist (S+Anta A2B) and S pretreated with thymoquinone and A2B antagonisti verilmiş ve uyarılmış (S+Anta A ), timokinon ile birlikte adenosine receptor antagonist (S+TQ+Anta A2B) guinea pigs 2B A2B antagonisti verilmiş ve uyarılmış (S+Anta A2B+TQ) ginedonumuzu Şekil 5. RT-PCR ile kan lenfositlerinde A2B adenozin reseptör gen (Her grupta n=6). Kontrol ve diğer gruplar arasındaki istatistiksel ekspresyonu analizi; Kontrol (C), uyarılmış (S), timokinon verilmiş S (S+TQ), A2B adenozin reseptör antagonisti verilmiş S (S+Anta A ) farklar: + P<0.05, ++ P<0.01, +++ P<0.001. Madde uygulanmış ve 2B ve timokinon ile birlikte A2B adenozin reseptör antagonisti verilmiş uyarılmış gruplar arasındaki istatistiksel farklar: * P<0.05, ** P<0.01, (S+TQ+Anta A2B) ginedonumuzu *** P<0.001 209 MIRZAMOHAMMADI, BARADARAN, SHANEHBANDI KEYHANMANESH, SHAHBAZFAR, PEJMAN Fig 8. Individual values and mean±SEM (big symbols with bars) of the gene expression of A2B adenosine receptor in lung tissue of control (C), sensitized (S), sensitized pretreated with thymoquinone (S+TQ), sensitized pretreated with selective A2B antagonist (S+Anta A2B) and sensitized pretreated with selective A2B antagonist and thymoquinone (S+Anta A2B+TQ) groups (for each group, n=7). Statistical differences between control and different groups: ++ P<0.01, +++ P<0.001, Statistical differences between pretreated groups vs sensitized group: * P<0.05, *** P<0.001 Şekil 8. Akciğer dokusunda A2B adenozin reseptör gen ekspresyonun bireysel değerleri ve ortalama ± SEM (Barlı büyük semboller). Kontrol (C), uyarılmış (S), timokinon verilmiş ve uyarılmış (S+TQ), A2A antagonisti verilmiş ve uyarılmış (S+Anta A2A), A2B antagonisti verilmiş ve uyarılmış (S+Anta A2B), timokinon ile birlikte A2A antagonisti verilmiş ve uyarılmış (S+Anta A2A+TQ), timokinon ile birlikte A2B antagonisti verilmiş ve uyarılmış (S+Anta A2B+TQ) ginedonumuzu (Her grupta n=6). Kontrol ve diğer gruplar arasındaki istatistiksel farklar: + P<0.05, ++ P<0.01. Madde uygulanmış ve uyarılmış gruplar arasındaki istatistiksel farklar: * P<0.05, ** P<0.01 Fig 7. A2B adenosine receptor gene expression analysis using RT- (P<0.05); however the mean value of IFN-γ in S+Anta A2A and PCR in lung tissue in the control (C), sensitized (S), S pretreated with S+TQ+Anta A groups was significantly lower than that in thymoquinone (S+TQ), S pretreated with A2B adenosine receptor 2A antagonist (S+Anta A2B) and S pretreated with thymoquinone and A the S group (P<0.01 to P<0.05). The mean value of IFN-γ 2B adenosine receptor antagonist (S+TQ+Anta A2B) guinea pigs in S+Anta A2A and S+TQ+Anta A2A groups was significantly Şekil 7. RT-PCR ile akciğer dokusunda A2B adenozin reseptör gen lower than that in S+TQ group (P<0.001, Fig. 10b). ekspresyonu analizi; Kontrol (C), uyarılmış (S), timokinon verilmiş S (S+TQ), A2B adenozin reseptör antagonisti verilmiş S (S+Anta A2B) ve timokinon ile birlikte A2B adenozin reseptör antagonisti verilmiş DISCUSSION (S+TQ+Anta A2B) ginedonumuzu The present study attempted to assess the effect of Blood IL-4 and IFN-γ Levels: The mean value of blood thymoquinone, alone and in the presence of A2A adenosine IL-4 level in S, S+Anta A2A, S+Anta A2B and S+TQ+Anta receptor antagonist, on the A2A and A2B adenosine receptor A2A groups was significantly higher than that in the C mRNA gene expression in blood lymphocytes and lung group (P<0.05). In S+TQ+Anta A2B group, this cytokine is tissue of ovalbumin-sensitized guinea pigs by the use of significantly lower than S group (P<0.01). The blood IL-4 Real Time PCR method. In addition, blood IL-4 and IFN-γ level in S+TQ group showed non-significant decrease level and lung pathological changes were analyzed. compared to that of the S group. However, the mean value of the IL-4 in this group was not significantly higher than The Effect of Thymoquinone on A2A Adenosine Receptor: that in the C group. There were not significant differences Data from these experiments in lymphocytes and lung between pretreated groups (Fig. 10a). tissue showed that thymoquinone could increase A2A adenosine receptor mRNA expression significantly; however, The mean value of the blood IFN-γ level of S, S+TQ, administration of selective antagonist of A2A adenosine S+Anta A2B and S+TQ+Anta A2B groups was significantly receptor decreased mRNA expression of A2A receptor. The higher than that of the C group (P<0.01 to P<0.05). There concurrent administration of these two exogenous factors was significant increase in blood IFN-γ of S+TQ and has a slight effect on the expression of A2A adenosine S+TQ+Anta A2B groups compared to that in the S group receptors. 210 Thymoquinone, the Main ... Fig 9. Photographs of lung specimen in guinea pigs: a- control normal lung tissues (C, 10x10), b- sensitized group (S, 10x40) with perivascular inflammatory infiltration, c- sensitized group pretreated with thymoquinone (S+TQ, 10x40) with airway smooth muscle hyperplasia and mild inflammatory infiltration, d- sensitized group pretreated with selective A2A antagonist (S+Anta A2A,10x10) with emphysema and atelectasis, e- sensitized group pretreated with selective A2B antagonist (S+Anta A2B, 10x10) with respiratory epithelial denudation, f- sensitized group pre- treated with selective A2A antagonist and thymoquinone (S+TQ+Anta A2A, 10x40) with vascular and airway smooth muscle hyperplasia and hyper- trophy and g- sensitized group pre- treated with selective A2B antagonist and thymoquinone (S+TQ+Anta A2B, 10x100) with inflammatory infiltration Şekil 9. Gine domuzlarında akciğer örneklerinin fotoğrafları. a- Kontrol normal akciğer dokusu (C, 10x10), b-uyarılmış grup (S, 10x40), peri- vasküler yangısal infiltrasyon, c- timo- kinon verilmiş ve uyarılmış grup (S+TQ, 10x40), havayollarında düz kas hiperplazisi ve orta şiddette yangısal infiltrasyon, d- A2A antagonisti uygu- lanmış ve uyarılmış grup (S+Anta A2A,10x10), amfizem ve atelektazi, e- A2B antagonisti uygulanmış ve uyarılmış grup (S+Anta A2B,10x10), respiratorik epitel dökülmesi, f- A2A antagonisti ile birlikte timokinon uygu- lanmış ve uyarılmış grup (S+TQ+Anta A2A, 10x40), vasküler ve havayolu düz kas hiperplazi ve hipertrofisi ve g- A2B antagonisti ile birlikte timo- kinon uygulanmış ve uyarılmış grup (S+TQ+Anta A2B, 10x100), yangısal infiltrasyon A2A adenosine receptors are known as the anti- by means of A2A receptors, the activation of these receptors inflammatory mediators that are highly expressed on can change the level of blood cytokines [27]. The expression lymphocytes [26]. Extracellular adenosine increases during of A2A receptors on lymphocytes correlates with adenosine asthma and inflammation and this elevated plasma levels in plasma and occupation of these receptors and adenosine level could activate A2A receptors. does not have any relationship with the response of A2A receptors [28]. In addition, the expression of A2A receptors is As extracellular adenosine has anti-inflammatory effects slightly sensitive to changes in concentration of exogenous 211 MIRZAMOHAMMADI, BARADARAN, SHANEHBANDI KEYHANMANESH, SHAHBAZFAR, PEJMAN with previous studies [5,21]. So thymoquinone probably influences the secretion of cytokines of different types of lymphocytes (Th2/Th1) and changes the activity of A2A receptors on the surface of lymphocytes and extracellular adenosine levels. Subsequently, these changes affect intra- cellular cAMP level and A2A receptors mRNA expression. A2A adenosine receptors have intermediate expression in lung tissue [29] and are most relevant to lung disease [30]. Administration of thymoquinone caused enhanced A2A receptor gene expression in lung tissue similar to the results of blood lymphocytes. A study in 2006 demonstrated that thymoquinone could affect IFN-γ level in bronchoalveolar lavage fluid [31]. So it is possible that thymoquinone might have affected lung cytokines secretion and induced intracellular mechanism of A2A adenosine receptor mRNA expression in lung tissue; however, this effect was weaker than blood lymphocytes. This elevated A2A receptor gene expression in lung tissue leads to wound healing and improving tissue destruction in group S + TQ during sensitization. Brown and his colleagues in 2008 showed that stimulation of wound healing in bronchial epithelial cells is the distinguished function of A2A adenosine receptor expression [2]. The level of IL-4 increased significantly in S+Anta A2A group although the level of IFN-γ decreased significantly in this group compared to the sensitized group. Administration of selective A2A adenosine receptor antagonist, ZM241385, caused the elimination of A2A adenosine receptor or the reduction of their numbers by decreasing cAMP level [32] and influencing secreted cytokines [33]. The previous study indicated that administration of this antagonist caused an increase in serum level of IL-4 and a decrease in IFN-γ [34]. As expression of pro-inflammatory cytokines can stimulate the gene expression of A2A adenosine receptor [35], Fig 10. The blood IL-4 (a) and IFN-γ (b) levels (pg/ml) of control (C), it has been suggested that A2A adenosine receptor sensitized (S), sensitized pretreated with thymoquinone (S+TQ), sensitized pretreated with selective A antagonist (S+Anta A ), antagonist and increased serum IL- 4 probably cause 2A 2A sensitized pretreated with selective A2B antagonist (S+Anta A2B), improvement of A2A receptors expression in lymphocytes. sensitized pretreated with selective A2A antagonist and thymoquinone Although the administration of this antagonist suppresses (S+Anta A2A+TQ)and sensitized pretreated with selective A2B antagonist and thymoquinone (S+Anta A +TQ) groups (for each group, n=6). the anti-inflammatory effect of A2A receptors on the cell 2B Statistical differences between control and different groups: + P<0.05, surface, but results of A2A receptor mRNA expression were ++ P<0.01, Statistical differences between pretreated groups vs controversial. Nowadays it is accepted that the level of sensitized group: * P<0.05, ** P<0.01 mRNA expression does not correlate exactly with proteins Şekil 10. Kan IL-4 (a) ve IFN-γ (b) seviyeleri (pg/ml). Kontrol (C), expressed on the cell surface because of some epigenetic uyarılmış (S), timokinon verilmiş ve uyarılmış (S+TQ), A2A antagonisti [36] verilmiş ve uyarılmış (S+Anta A2A), A2B antagonisti verilmiş ve uyarılmış factors . (S+Anta A2B), timokinon ile birlikte A2A antagonisti verilmiş ve uyarılmış (S+Anta A +TQ), timokinon ile birlikte A antagonisti verilmiş ve The results of the present study indicate that all 2A 2B uyarılmış (S+Anta A2B+TQ) ginedonumuzu (Her grupta n=6). Kontrol ve pathological criteria significantly increased in S+Anta A2A diğer gruplar arasındaki istatistiksel farklar: + P<0.05, ++ P<0.01. Madde group compared to controls. Spicuzza in 2006 demonstrated uygulanmış ve uyarılmış gruplar arasındaki istatistiksel farklar: * P<0.05, that ZM241385, selective A adenosine receptor anta- ** P<0.01 2A gonist, could affect respiratory smooth muscle and blocking of these receptors exacerbated asthmatic symptoms [29]. and endogenous factors involved in inflammation [29]. On the other hand, thymoquinone as an exogenous factor The results of this investigation showed a significant could change blood cytokine secretion (IL-4 & INF-γ) in reduction in gene expression of A2A adenosine receptor the process of asthma; these changes were in accordance in S+TQ+Anta A2A group compared to the S + TQ and S 212 Thymoquinone, the Main ... + Anta A2A groups. It is suggested that thymoquinone There was not a statistically significant difference between prevented the secretion of blood cytokines during the A2B receptors gene expression and pathological changes sensitization process [5,21] and the elevated level of IL-4 did in this group and the control group. This indicated that not occur to stimulate A2A adenosine receptor expression administration of A2B receptor antagonist could prevent during administration of selective A2A adenosine receptor asthma induced inflammatory changes. antagonist. It is demonstrated that the anti-inflammatory and There were not significant differences between A2A pro-inflammatory effects of adenosine depend on their adenosine receptor expression in lung tissue of group level in lung tissue. Lung inflammation causes a hypoxic S+TQ+Anta A2A and S+TQ group. According to the results environment in which adenosine is produced. At first, of the present study, it is concluded that thymoquinone the low level of adenosine stimulates high-affinity had a significant effect on A2A receptor expression in receptors such as A2A adenosine receptors which shows respiratory epithelial cells since respiratory epithelial the protective effect of adenosine. However, in severe cells express A2A adenosine receptors, although the A2A lung inflammatory conditions, the high level of produced receptors expression and its regulation under inflammatory adenosine affects low-affinity receptors such as A2B conditions in epithelial cells have not been documented receptors and exacerbates the inflammation [39]. and the biological importance of increased expression on epithelial cells is unknown [35]. Our results suggest The gene expression of A2B receptor, pathological that the A adenosine receptors probably play a role in changes and blood IL-4 level in the sensitized group 2A the pathogenesis of inflammatory diseases. A previous pretreated by thymoquinone and Anta A2B (S+TQ+Anta study of ours showed that concurrent administration A2B group) were not statistically different from the control of thymoquinone and selective adenosine A receptor group. Also, the blood level of IFN-γ in S+TQ+Anta A2B2A antagonist improved tracheal smooth muscle contraction group rose significantly compared to the control and and WBC count in bronchoalveolar lavage fluid in sensitized groups. Moreover, in the S+TQ+Anta A2B group, comparison with the S+Anta A group [37]. Polosa’s study the administration of thymoquinone and selective anta-2A also showed that ZM241385, selective A adenosine gonist together caused more improvement than S+TQ 2A antagonist, affected bronchial smooth muscle [30]. and S+AntaA2B groups. These results are in accordance with results of our current study [37] which is related to the The Effect of Thymoquinone on A2B Adenosine effect of administration of thymoquinone and A2B receptor Receptor: The second part of this study evaluated the effect antagonist together to relieve inflammation. of thymoquinone on blood cytokines, lung pathology and the gene expression of A adenosine receptors, in the Cytokines can regulate the number of adenosine 2B [40] presence of MRS1706; selective A receptor antagonist, in receptors in inflammatory environment and our previous 2B asthmatic guinea pigs. study demonstrated that IFN-γ level in sensitized group pretreated with A2B receptor antagonist group has increased The gene expression of A2B receptors in sensitized significantly compared to the S group and this change animals (S group) and pretreated group with thymoquinone could influence the expression of adenosine receptors (S+TQ group) significantly increased compared to controls. or T-cells [34]. These observations, therefore, support the This increase of expression in S group and S+TQ group hypothesis that blocking of A2B receptor with selective was 86% and 72% respectively. In these groups, the blood antagonist probably causes changes in levels of secreted IL-4 and IFN-γ levels and pathological changes were cytokines related to inflammation. These findings are significantly raised in comparison to the control group. in accordance with the results of Anvari’s study which These findings were in accordance with results of our showed that in A2B receptor-knockout mice, the expression previous studies [19,34,38]. The increment in A2B receptors gene and secretion of T-cell decreases significantly [41]. expression, cytokines and pathological changes in S+TQ group compared with C group was due to inflammation The results of gene expression of A2B adenosine process but there was statistically significant reduction receptors in lung tissue are already similar to the findings in in comparison with the S group. This supports the notion blood lymphocytes. The comparison of percentage of gene that thymoquinone can improve inflammation and relieve expression of A2B receptor in blood lymphocytes and lung its symptoms. tissue in the analyzed groups showed that thymoquinone administration has more influence on blood lymphocytes This study showed that single dose administration of while administration of the selective A2B receptor antagonist MRS1706, selective A2B adenosine receptor antagonist, was more effective in lung tissue. It was probably due to could improve lung pathological changes; however, it high expression of A2B receptor in pulmonary resident could not decrease to the control level. These results are cells; epithelial, bronchial smooth muscle and endothelial in line with Mustafa’s study [16]. In addition, the percentage cells, because the pre-inflammatory effect of A2B receptor of increase in A [41]2B receptor gene expression in S+Anta A2B stimulation was demonstrated in these cells . On the group significantly plummeted compared to the S group. other hand, this receptor could increase the expression of 213 MIRZAMOHAMMADI, BARADARAN, SHANEHBANDI KEYHANMANESH, SHAHBAZFAR, PEJMAN pre-inflammatory mediators in different cells of chronic 2222.2008.03034.x pulmonary diseases and over-expression of Th2 cytokine in 10. Stefania G, Kitia V, Stefania M, Eleonora F, Valeria S, Annalisa B, lung was associated with increasing levels of A receptor [42]. Edward L, Stephen ML, Pier AB: Adenosine and lymphocyte regulation. 2B While local cytokines played an important role in regulating Purinergic Signal, 3, 109-116, 2007. DOI: 10.1007/s11302-006-9042-y pre/anti-inflammatory activities of adenosine, and 11. Palmer TM, Trevethick MA: Suppression of inflammatory and immune responses by A2a adenosine receptor. Br J Pharmacol, 153, while these cytokines could also regulate the levels of S27-S34, 2008. DOI: 10.1038/sj.bjp.0707524 adenosine metabolic enzymes and adenosine receptors 12. Huang S, Apasov S: Role of A2a extracellular adenosine receptor in inflammatory environment [40], MRS1706, selective A2B mediated signalling in adenosine mediated inhibition of T cell activation receptor antagonist, probably inhibits their influence on and expansion. Blood, 90, 1600-1610, 1997. the expression of pre-inflammatory mediators by blocking 13. Feoktistov I, Biaggioni I: Adenosine A2B receptors. Pharmacol Rev, receptors. However, it is suggested that the effects of 49 (4): 381-402, 1997. agonists of adenosine receptors are evaluated in future 14. Feoktistov I, Polosa R, Holgate S, Biaqqioni I: Adenosine A2b researches to determine the exact mechanism(s) of receptor: A novel therapeutic target in asthma? Trends Pharmacol Sci, 19, 148-53, 1998. DOI: 10.1016/S0165-6147(98)01179-1 thymoquinone. 15. Fozard J R, Baur F, Wolber C: Antagonist pharmacology of adenosine In conclusion, the results showed that thymoquinone A2B receptors from rat, guinea pig and dog. Eur J Pharmacol, 475, 79-84, 2003. DOI: 10.1016/S0014-2999(03)02078-8 could affect A2A and A2B adenosine receptors gene expression 16. Mustafa S, Nadeem A, Fan M, Zhong H, Belardinelli L, Zeng D: and some of the therapeutic effects of thymoquinone in Effect of a specific and selective A2B adenosine receptor antagonist on reducing asthma symptoms might be partially mediated adenosine agonist AMP and allergen-induced airway responsiveness and through A adenosine receptors. cellular influx in a mouse model of asthma. J Pharmacol Exp Ther, 320, 2 1246-1251, 2007. DOI: 10.1124/jpet.106.112250 Acknowledgement 17. Kalus U, Pruss A, Bystron J, Jurecka M, Smekalova A, Lichius JJ, Kiesewetter H: Effect of Nigella sativa (black seed) on subjective feeling This is a report of a database from the thesis entitled in patients with allergic diseases. Phytother Res, 17, 1209-1214, 2003. “The evaluation of the effect of thymoquinone on A and DOI: 10.1002/ptr.13562A A adenosine receptors’ gene expression in ovalbumin- 18. Hajhashemi V, Ghannadi A, Jafarabadi H: Black cumin seed 2B induced asthmatic guinea pigs” registered in Drug Applied essential oil, as a potent analgesic and anti-inflammatory drug. Phytother Res, 18 (3): 195-199, 2004. Research Center of Tabriz University of medical sciences. 19. Keyhanmanesh R, Gholamnezhad Z, Boskabady MH: The relaxant effect of Nigella sativa on smooth muscles, its possible mechanisms and conflict of interest: None declared. clinical applications. IJBMS, 17, 939-949, 2014. 20. Gholamnezhad Z, Keyhanmanesh R, Boskabady MH: Anti- REFERENCES inflammatory, antioxidant, and immunomodulatory aspects of Nigella sativa for its preventive and bronchodilatory effects on obstructive 1. Shin I-S, Ahn K-S, Shin N-R, Jeon CM, Kwon OK, Lee K, Oh SR: respiratory diseases: A review of basic and clinical evidence. J Funct Homoegonol attenuates the asthmatic responses induced by ovalbumin Foods, 17, 910-927, 2015. DOI: 10.1016/j.jff.2015.06.032 challenge. Pharmacal Research, 37, 1201-1210, 2014. DOI: 10.1007/ 21. Keyhanmanesh R, Boskabady M, Eslamizadeh M, Khamneh S, s12272-013-0327-8 Saadatlou MA: The effect of thymoquinone, the main constituent of 2. Brown R, Spina D, Page C: Adenosine receptors and asthma. Br J Nigella sativa on tracheal responsiveness and white blood cell count Pharm, 153 (S1): S448-S456, 2008. DOI: 10.1038/bjp.2008.22 in lung lavage of sensitized guinea pigs. Planta Med, 75, 1-5, 2009. DOI: 3. Shi HZ, Qin XJ: CD4/CD25 regulatory T lymphocytes in allergy and 10.1055/s-0029-1186054 asthma. Allergy, 60, 986-995, 2005. DOI: 10.1111/j.1398-9995.2005.00844.x 22. Boskabady MH, Keyhanmanesh R, Khamneh S, Ebrahimisaadatlou 4. Schmidt-Weber C, Blaser K: The role of the FOXP3 transcription factor MA: The effect of Nigella sativa extract on tracheal responsiveness and in the immune regulation of allergic asthma. Curr Allergy Asthma Rep, 5, lung inflammation in ovalbumin-sensitized guinea pigs. Clinics, 66, 879- 356-361, 2005. 887, 2011. DOI: 10.1590/S1807-59322011000500027 5. Keyhanmanesh R, Boskabady MH, Khamneh S, Doostar Y: Effect of 23. El Aziz AEA, El Sayed NS, Mahran LG: Anti-asthmatic and anti- thymoquinone on the lung pathology and cytokine levels of ovalbumin- allergic effects of thymoquinone on airway-induced hypersensitivity in sensitized guinea pigs. Pharmacol Rep, 62, 910-916, 2010. DOI: 10.1016/ experimental animals. J Applied Pharmaceut Sci, 1, 109-117, 2011. S1734-1140(10)70351-0 24. Fozard JR, McCarthy C: Adenosine receptor ligands as potential 6. Boskabady MH, Keyhanmanesh R, Khamneh S, Doostar Y, Khakzad therapeutics in asthma. Curr Opin Investig Drugs, 3, 69-77, 2002. MR: Potential immunomodulation effect of the extract of Nigella sativa 25. Saadat S, Mohammadi M, Fallahi M, keyhanmanesh R, Aslani on ovalbumin sensitized guinea pigs. JZUS, 12, 201-209, 2011. DOI: MR: The protective effect of a-hederin, the active constituent of Nigella 10.1631/jzus.B1000163 sativa, on tracheal responsiveness and lung inflammation in ovalbumin- 7. Alexander SPH, Mathie A, Peters JA: Guide to receptors and channels sensitized guinea pigs. J Physiol Sci, 65, 285-292, 2015. DOI: 10.1007/ (GRAC). 3rd ed., Br J Pharmacol, 153 (Suppl. 2): S1-S209, 2008. DOI: 10.1038/ s12576-015-0367-6 sj.bjp.0707746 26. Mills JH, Kim DG, Krenz A, Bynoe MS: A2A adenosine receptor 8. Huszar E, Vass G, Vizi E, Csoma Z, Barat E, Molnar Vilaqos G, signaling in lymphocytes and the central nervous system regulates Herjavecz I, Horvath I: Adenosine in exhaled breath condensate in inflammation during experimental autoimmune encephalomyelitis. J healthy volunteers and in patients with asthma. Eur Respir J, 20, 1393- Immunol, 188, 5713-5722, 2012. DOI: 10.4049/jimmunol.1200545 1398, 2002. DOI: 10.1183/09031936.02.00005002 27. Hasko G, Pacher P: A2A receptors in inflammation and injury: Lessons 9. Smith N, Broadley K: Adenosine receptor subtypes in the airways learned from transgenic animals. J Leukoc Biol, 83, 447-455, 2008. DOI: responses to 5-adenosine monophosphate inhalation of sensitized 10.1189/jlb.0607359 guinea-pigs. Clin Exp Allergy, 38, 1536-1547, 2008. DOI: 10.1111/j.1365- 28. Jacquin L, Franceschi F, By Y, Durand-Gorde JM, Condo J, Deharo 214 Thymoquinone, the Main ... JC, Michelet P, Fenouillet E, Guieu R, Ruf J: Search for adenosine A2A the proximal promoter. J Immunol, 177 (10): 7173-7183, 2006. spare receptors on peripheral human lymphocytes. FEBS Open Bio, 3, 36. Schiedel AC, Lacher SK, Linnemann C, Knolle PA, Müller CE: 1-5, 2013. DOI: 10.1016/j.fob.2012.11.004 Antiproliferative effects of selective adenosine receptor agonists and 29. Spicuzza L, Di Maria G, Polosa R: Adenosine in the airways: Implications antagonists on human lymphocytes: Evidence for receptor-independent and applications. Eur J Pharmacol, 533, 77-88, 2006. DOI: 10.1016/j. mechanisms. Purinergic Signal, 9, 351-365, 2013. DOI: 10.1007/s11302- ejphar.2005.12.056 013-9354-7 30. Polosa R: Adenosine-receptor subtypes: Their relevance to adenosine- 37. Pejman L, Omrani H, Mirzamohammadi Z, Keyhanmanesh R: mediated responses in asthma and chronic obstructive pulmonary disease. Thymoquinone, the main constituent of Nigella sativa, affects adenosine Eur Respir J, 20, 488-496, 2002. DOI: 10.1183/09031936.02.01132002 receptors in asthmatic guinea pigs. Iran J Basic Med Sci, 17, 1012-1019, 31. El Gazzar M, El Mezayen R, Marecki JC, Nicolls MR, Canastar A, 2014. Dreskin SC: Anti-inflammatory effect of thymoquinone in a mouse 38. Keyhanmanesh R, Pejman L, Omrani H, Mirzamohammadi Z, model of allergic lung inflammation. Int Immunopharmacol, 6, 1135-1142, Shahbazfar AA: The effect of single dose of thymoquinone, the main 2006. DOI: 10.1016/j.intimp.2006.02.004 constituents of Nigella sativa, in guinea pig model of asthma. BioImpacts, 32. Nadeem A, Fan M, Ansari HR, Ledent C, Jamal Mustafa S: 4 (2): 75-81, 2014. Enhanced airway reactivity and inflammation in A2A adenosine receptor- 39. Blackburn MR, Lee CG, Young HWJ, Zhu Z, Chunn JL, Kang MJ, deficient allergic mice. Am J Physiol Lung Cell Mol Physiol, 292, 335-344, Banerjee SK, Elias JA: Adenosine mediates IL-13-induced inflammation 2007. DOI: 10.1152/ajplung.00416.2006 and remodeling in the lung and interacts in an IL-13-adenosine 33. Koshiba M, Rosin DL, Hayashi N, Linden J, Sitkovsky MV: Patterns amplification pathway. J Clin Investigation, 112, 332-344, 2003. DOI: of A2A extracellular adenosine receptor expression in different functional 10.1172/JCI200316815 subsets of human peripheral T cells. Flow cytometry studies with anti- 40. Zhou Y, Schneider J D, Blackburn MR: Adenosine signaling and the A2A receptor monoclonal antibodies. Mol Pharmacol, 55 (3): 614-624, regulation of chronic lung disease. Pharmacol Ther, 123, 105-116, 2009. 1999. DOI: 10.1016/j.pharmthera.2009.04.003 34. Pejman L, Omrani H, Mirzamohammadi Z, Shahbazfar AA, Khalili 41. Anvari F, Sharma A K, Fernandez L G, Hranjec T, Ravid K, Kron M, Keyhanmanesh R: The effect of adenosine A2A and A2B antagonists on IL, Laubach VE: Tissue-derived proinflammatory effect of adenosine A2B tracheal responsiveness, serum levels of cytokines and lung inflammation receptor in lung ischemia-reperfusion injury. J Thorac Cardiovasc Surg, in guinea pig model of asthma. Adv Pharmaceut Bulletin, 4, 131-138, 140, 871-877, 2010. DOI: 10.1016/j.jtcvs.2010.06.051 2014. DOI: 10.5681/apb.2014.020 42. Polosa R, Blackburn MR: Adenosine receptors as targets for 35. Morello S, Ito K, Yamamura S, Lee KY, Jazrawi E, Desouza P, therapeutic intervention in asthma and chronic obstructive pulmonary Barnes P, Cicala C, Adcock IM: IL-1 and TNF-regulation of the adenosine disease. Trends Pharmacol Sci, 30, 528-535, 2009. DOI: 10.1016/j. receptor (A2A) expression: Differential requirement for NF-ƘB binding to tips.2009.07.005 Kafkas Univ Vet Fak Derg KafKas Universitesi veteriner faKUltesi Dergisi 22 (2): 215-220, 2016 JoUrnal Home-Page: http://vetdergi.kafkas.edu.tr Research Article DOI: 10.9775/kvfd.2015.14142 online sUbmission: http://vetdergikafkas.org The Effects of Erythropoietin on the Penicillin Induced Epileptiform Activity in Rats [1] Şule BULUR 1 Şerif DEMİR 1 Anzel BAHADIR 2 Seyit ANKARALI 1 Recep ÖZMERDİVENLİ 1 Ersin BEYAZÇİÇEK 1 [1] This study was financed by the University of Duzce, Scientific Research Projects Department of Duzce-Turkey (Project No: 2010.04.01.03) 1 Department of Physiology, Duzce University, Medical School, TR-81620 Duzce - TURKEY 2 Department of Biophysics, Duzce University, Medical School, TR-81620 Duzce - TURKEY Article Code: KVFD-2015-14142 Received: 01.08.2015 Accepted: 11.11.2015 Published Online: 11.11.2015 Abstract Erythropoietin (Epo), a cytokine hormone produced in the kidney, promotes the formation of red blood cells in the bone marrow. The penicillin-induced epilepsy model is a commonly used experimental model for epilepsy research. The present study was conducted to elucidate the effect of Epo on penicillin-G (500 IU/2.5 µl dose, intracortically (i.c)) -induced epileptiform activity in anesthetized adult Wistar-Albino rats (n=39). The animals were randomly divided into four groups as three treatment groups (groups 1-3) and a control group (no drug application). Rats in groups 1, 2 and 3 were intraperitoneally administered 2.000, 4.000 and 6.000 IU Epo/ kg, respectively. The effects on penicillin G induced epilepsy were compared across groups using electrocorticography. Epo at 2.000 IU/kg did not cause a significant change (P>0.05) in epileptiform spike-wave activity (number/min) and/or amplitude (µV) values, whereas the average number of spike-waves per minute and seizure severity decreased significantly in the 4.000 and 6.000 IU/kg Epo groups compared with the control (P<0.05). Consequently, the results of the present study show that administration of Epo has a dose- dependent antiepileptic effect in penicillin induced model of epilepsy in rats. Keywords: Erythropoietin, Electrocorticography, Epilepsy, Penicillin, Rat Sıçanlarda Penisilin ile Oluşturulan Epileptiform Aktivitesi Üzerine Eritropoietinin Etkileri Özet Eritropoietin (Epo), böbreklerde sentezlenen ve kemik iliğinde eritrosit üretimini sağlayan bir sitokin hormonudur. Deneysel epilepsi araştırmalarında, genel olarak penisilin ile oluşturulan epilepsi modeli kullanılmaktadır. Çalışmamızda, anestezi altındaki yetişkin Wistar- Albino türü sıçanlarda (n=39), Penisilin-G (intrakortikal (i.c) olarak, 500 I.U/2.5 µl dozda) ile oluşturulmuş epileptik aktivite üzerine Epo’nun etkileri araştırıldı. Sıçanlar, üç tedavi grubu (grup 1-3) ve bir kontrol grubu (ilaç uygulanmadı) olarak rastgele dört farklı gruba ayrıldı. Grup 1, 2 ve 3’de bulunan sıçanlara, intraperitonal olarak sırayla 2.000, 4.000 and 6.000 IU Epo/kg’lık dozlarda Epo uygulandı. Gruplar arasında, penisilin G ile oluşturulan epilepsi üzerine Epo’nun etkisi elektrokortikografi kullanılarak karşılaştırıldı. Kontrol grubu ile Epo grubu karşılaştırıldığında, 4.000 ve 6.000 IU/kg Epo uygulaması, dakika başına diken dalgaların ve dikenlerin ortalama sayısı ve nöbet şiddetini anlamlı (P<0.05) derecede azaltır iken, 2.000 IU/kg Epo uygulamasında epileptiform diken dalga akitivitesi (sayı/dk) ve/ veya genlik (µV) değerlerinde anlamlı bir değişime neden olmadı (P>0.05). Sonuç olarak yapılan çalışma, Epo’nun sıçanlarda penisilin ile oluşturulmuş deneysel epilepsi modeli üzerine uygulanmasının, doz bağımlı antiepileptik etkiye neden olduğu ortaya çıkarmıştır. Anahtar sözcükler: Eritropoietin, Elektrokortikografi, Epilepsi, Penisilin, Sıçan INTRODUCTION the population, and approximately 10% of the general population has one or more seizures during their lifetime [2]. Epilepsy is a clinical condition characterized by Experimental investigations of epilepsy in animal models spontaneous recurrent seizures of cerebral origin [1]. As a have contributed important information regarding epilepsy common chronic neurological disorder, it affects 1-3% of pathogenesis [3,4]. Experimental epilepsy is induced by  İletişim (Correspondence)  +90 536 6912092, Fax: +90 380 5421302  serifdemir19@hotmail.com 216 The Effects of Erythropoietin ... penicillin, topically or intracortically (i.c.) administered at in a stereotaxic frame (Harvard Apparatus, Holliston, MA, the surface of the cortex. The penicillin-induced epilepsy USA). The left cerebral cortex was exposed by craniotomy. model has been used in numerous studies. Penicillin Two Ag-AgCl ball electrodes were placed over the left causes acute focal epileptic activity similar to that which somatomotor cortex (first electrode: 2 mm lateral to sagittal decreases the activity of the GABA inhibitory system in the suture, 1 mm anterior to bregma; second electrode: 2 mm brain and increases glutamate, which becomes the main lateral to sagittal suture, 5 mm posterior to bregma). The excitatory neurotransmitter in the brain [5-9]. Researchers [6-9] common reference electrode was fixed on the right pinna. continue to study the antiepileptic effects of agents Electrocorticography (ECoG) recordings were continuously in animal models of experimental epilepsy, but the monitored. The signals from the electrodes were amplified therapeutic effectiveness of these agents may not be the and filtered (0.1-50 Hz bandpass) using bio-amplifiers same in humans [10,11]. (BioAmp; AD Instruments, Bella Vista NSW, Australia). Then the ECoG signal was digitized at a sampling rate of 1024 Erythropoietin (Epo), a hematopoietic glycoprotein cytokine hormone produced in the kidney, promotes red using a four-channel data acquisition system (PowerLab 8/ blood cell formation in bone marrow and is expressed in SP; AD Instruments). Baseline activity was recorded for 10 other tissues, including the nervous system. Epo mediates min in each group. a number of biological actions in the central nervous An epileptic focus was produced by intracortical system (CNS), where it is also neuroprotective [12-15]. Epo injection of penicillin G (500 IU/2.5 µl) in all animals. Using can cross the blood–brain barrier (BBB) via a receptor- a Hamilton microsyringe (type 701 N; Hamilton Co., Reno, mediated mechanism [16]. Uzum et al.[17] have shown that NV, USA), penicillin was injected into the left sensorimotor Epo pretreatment confines BBB leakage to the cerebellum cortex (2 mm posterior to bregma, 3 mm lateral to the and cortical areas and lessens the intensity of tonic-clonic sagittal suture, and 1 mm beneath the brain surface) seizures during pentylentetrazol-induced seizures. at an infusion rate of 0.5 µl/min. Epileptiform activity In recent years, many studies have investigated the was observed by ECoG for 5-6 min. Activity reached a presence and protective effect of Epo and the erythro- constant level within 30 min following the administration poietin receptor (EpoR) on neurons, demonstrating both of penicillin G and lasted for 3-5 h. After about 30 min epileptic and antiepileptic effects of Epo in different when the spike-waves become stable, the rats were given experimental animal models [17-23]. However, no study intraperitoneally Epo at a dose of 2.000, 4.000, or 6.000 has shown the effects of Epo in a penicillin-induced IU/kg. All recordings were displayed and stored using a experimental epilepsy model. Here, we report the effect computer. Spike frequencies and amplitudes for each of Epo at various doses on epilepsy after seizure animal were automatically calculated and measured using the data-acquisition Chart v.5.1.1 system (PowerLab MATERIAL and METHODS software; AD Instruments). The frequency and amplitude of epileptic activity were analyzed offline. Experimental Procedures Statistics A total number of thirty-nine adult male Wistar-Albino The frequency and amplitude values acquired rats (200-250 g; 12-14 weeks) were used in this study. These from animals in all groups were converted to a scaling rats were taken by Duzce University Medical and Surgical percentage in a time-dependent manner. The percentage Research Center, Duzce-Turkey before experiment and they changes were used for statistical analyses and graphics. All were housed in groups of 4-5 per cage (42x26x15 cm) in a room with controlled temeparature (21±2°C) and relative statistical procedures were performed using SPSS statistical humudity (60±5%) with lights on from 8:00-20:00. This software package version 12.0 (SPSS, Inc., Chicago, IL, USA). study was approved by the Duzce Animal Care and Usage Data are expressed as means±SD. The data were analyzed University Ethics Committee (Approval Number: 2009-24). by one-way analysis of variance followed by Tukey’s post Animal handling during all experiments was consistent hoc test to correct for multiple comparisons of treatments. with the National Institutes of Health Guidelines for the Statistical significance was accepted at P<0.05. Care and Use of Laboratory Animals (NIH Publication No. 85-23). RESULTS Rats were randomly assigned to the following groups: The penicillin-induced epileptiform discharges were (1) 500 IU penicillin (2.5 µl, i.c.) control group (n=10); (2) 500 characterized by bilateral spikes and spike-wave complexes IU penicillin (2.5 µl, i.c.) + 2.000 IU/kg Epo (n=10); (3) 500 IU on a background of ECoG activity (Fig. 1). Data comprising penicillin (2.5 µl, i.c.) + 4.000 IU/kg Epo (n=9); and (4) 500 mean spike frequency and mean spike amplitude, IU penicillin (2.5 µl, i.c.) + 6.000 IU/kg Epo (n=10) groups. and latencies to onset of epileptiform activity in all All rats were anesthetized with 1.25 g/kg intraperitoneal experimental groups during 120 min record following urethane (Sigma Aldrich Co., St. Louis, MO, USA) and placed penicillin injection. Epo was administered 30 min after 217 BULUR, DEMİR, BAHADIR, ANKARALI ÖZMERDİVENLİ, BEYAZÇİÇEK Fig 1. Changes in ECoG activity after administration of penicillin G Şekil 1. Penisilin G verilmesinden sonra ECoG aktivitesinde değişiklikler Table 1. Number of spike or spike-wave discharges per minute (number/minute) at each dose during each period (mean±SD and P values) Tablo 1. Farklı dozlarda uygulanan EPO nun, her bir periyot aralığındaki dakikadaki diken dalga deşarjı sayıları (sayı/dk) (ortalama±SD ve P değerleri) Treatment Period Erythropoietin Treatment (dose) 1 (min) P Value 2 Control group (n:10) 2.000 IU/kg (n:10) 4.000 IU/kg (n:9) 6.000 IU/kg (n:10) Baseline 31.78±10.3 27.70±11.0 34.64±13.2 34.80±11.2 - 1-10 32.09±13.2 27.34±12.0 29.92±9.2 32.61±17.5 0.229 11-20 33.58±12.9 24.38±13.5 26.11±8.0a 29.33±15.1 0.018 a 21-30 30.44±11.1 22.35±12.3 23.35±6.4a 24.64±15.1b 0.034 a,b 31-40 30.44±12.0 20.81±11.5 22.16±5.5a 23.25±13.2 b 0.027 a,b 41-50 29.45±12.6 16.88±13.5 18.95±5.9 a 19.73±14.7 b 0.034 a,b 51-60 27.72±13.0 16.01±13.6 15.11±9.0a 15.94±15.3 b 0.037 a,b 61-70 26.47±13.5 14.93±13.4 14.27±9.1 17.31±16.9 0.099 71-80 24.71±13.2 13.31±12.5 13.70±9.3 18.29±20.0 0.224 81-90 22.71±11.4 12.07±11.4 13.07±9.3 17.97±22.0 0.310 91-100 20.42±8.8 11.99±12.6 12.23±9.6 13.08±17.1 0.196 101-110 19.25±7.4 12.21±13.3 12.09±10.0 11.80±14.2 0.191 111-120 16.87±5.2 10.86±12.7 11.76±10.1 8.18±11.2 0.133 1 Values are the mean±SD for rats in each group, 2 Statistical significance; P<0.05; a,b P<0.05: Compared with control the penicillin injection. The mean spike-wave frequencies DISCUSSION of each group are shown in Table 1. The mean number of spike-waves per minute wave frequencies in 4.000 IU and In the present study, we investigated the antiepileptic 6.000 IU Epo doses between 21-30, 41-50, 51-60 minutes effects of Epo in penicillin induced epilepsy in rats. This is time period were significantly (P<0.05) decreased than the first study to demonstrate that Epo has an antiepileptic control groups. Also, the spike wave frequencies in 4.000 IU effect in the penicillin G-induced experimental epilepsy Epo dose between 11-20 min time period were significantly model. Epo at doses of 4.000-6.000 IU/kg inhibited the rate (P<0.05) decreased than control groups. However, at 2.000 of spikes and spike-waves. IU, Epo produced no significant change in the spike-wave frequency of epileptiform activity (Table 1). Additionally, Many researchers [18,19,23] have investigated the effects there were no significant differences between all groups of Epo in different experimental models of epilepsy. In a of Epo in terms of spike wave amplitude (µV) of penicillin- kainic acid (KA)-induced seizure model in rats, Kondo et induced epileptiform activity (P>0.05) (Table 2). al.[18] used intraventricular infusion of anti-Epo antibody 218 The Effects of Erythropoietin ... Table 2. Spike-wave amplitudes (µV) at each dose during each period (mean±SD and P values) Tablo 2. Farklı dozlarda uygulanan EPO nun, her bir periyot aralığındaki diken dalga amplitütleri (μV) (ortalama±SD ve P değerleri) 1 Treatment Period Erythropoietin Treatment (dose) 2 (min) P ValueControl Group (n:10) 2.000 IU/kg (n:10) 4.000 IU/kg (n:9) 6.000 IU/kg (n:10) Baseline 0.66±0.2 0.96±0.4 0.85±0.2 0.85±0.4 - 1-10 0.71±0.3 0.99±0.4 0.89±0.3 0.86±0.4 0.979 11-20 0.71±0.3 0.88±0.3 0.87±0.3 0.82±0.3 0.713 21-30 0.75±0.3 0.84±0.2 0.88±0.4 0.78±0.4 0.598 31-40 0.75±0.3 0.77±0.3 0.85±0.4 0.78±0.4 0.533 41-50 0.74±0.3 0.65±0.4 0.80±0.4 0.69±0.2 0.319 51-60 0.76±0.3 0.60±0.4 0.61±0.6 0.49±0.1 0.266 61-70 0.76±0.2 0.60±0.5 0.55±0.6 0.46±0.2 0.226 71-80 0.72±0.2 0.58±0.4 0.50±0.5 0.39±0.2 0.190 81-90 0.67±0,2 0.56±0.4 0.45±0.4 0.30±0.2 0.182 91-100 0.65±0.2 0.50±0.5 0.43±0.4 0.26±0.2 0.168 101-110 0.62±0.2 0.49±0.5 0.41±0.4 0,32±0,2 0.231 111-120 0.69±0.2 0.48±0.5 0.41±0.4 0,28±0,2 0.110 1Values are the mean± SD for rats in each group, 2 Statistical significance; P<0.05 to reveal the antiepileptic effect of endogenous Epo and microgliosis caused by neurodegenerative changes. Won intraventricular infusion of anti-neuropeptide Y antagonist et al.[30] demonstrated that Epo protects spinal GABAergic to eliminate the neuroprotective effect of exogenous Epo. neurons against KA-excitotoxic damage in rat spinal cord Chu et al.[19] studied the effects of Epo (5.000 IU/kg) in a cell cultures. They [30] found that post-treatment with Epo lithium-pilocarpine-induced status epilepticus (SE) model for 48 h after KA-induced injury remarkably enhanced the and reported that Epo administration during the latent expression of EpoR and glutamate decarboxylase 67, which period following SE prevented BBB leakage, neuronal is an isoform of a GABA-producing enzyme diminished death, and microglia activation in the dentate hilus, CA1, by KA. They suggested that the neuroprotective effect of and CA3; inhibited the generation of ectopic granule cells post-treatment Epo on the GABAergic neurons is mediated in the hilus and new glia in CA1; and reduced the risk for by signal transduction involving the EpoR-dependent developing spontaneous recurrent seizures. Another study [23] Janus kinase 2 pathway. We showed an anticonvulsant also demonstrated that Epo administration reduced effect of Epo in a penicillin-induced epilepsy model by seizure activity in the lithium-pilocarpine-induced SE antagonizing suppressed GABA inhibition. In addition, model. Sozmen et al.[22] showed that Epo significantly Morishita et al.[31] reported that Epo protected cultured decreased neuronal cell death in CA1, CA2, CA3, and the neurons from glutamate neurotoxicity mediated by dentate gyrus of the hippocampus. N-methyl-D-aspartate receptors, in a dose and time dependent manner; glutamate-dependent neuronal cell In literature, it has been shown that Epo/erythro- death was reduced by low Epo doses administered 24 h poietin receptors (EpoR) has anti-toxic, anti-oxidant, anti- before glutamate exposure, whereas high Epo doses were inflammatory and anti-apoptatic effects in different not effective. In a more recent study, pretreatment with tissues [24,25] in vivo and in vitro studies. The Epo/ EpoR Epo 24 h before the experiment antagonized glutamate- plays an important role in neurodevolepment and neuro- mediated astrocyte water permeability in mice, thereby protection. Also, it is thought that Epo increases the choline reducing neurological symptoms [32]. acetyltransferase enzyme activity and reduce the epileptic activity with cholinergic effects in neurons [26]. Also, Epo has Attempts have been made to explain the mechanism neurotrophic properties for neuronal stem cell mobilization of action of Epo in experimental models of epilepsy. Our in damaged regions [27]. In the epilepsy process, cellular observations provide direct evidence that Epo has dose- events underlying the neuroprotective effects of Epo are dependent antiepileptic effects in a penicillin G induced dependent on an increase in the total number of (EpoR) epilepsy model. We revealed that Epo at doses of 4.000- and anti-apoptatic (Bcl-2, Bcl-w) molecules, and the total 6.000 IU/kg was effective in reducing the frequency, number of pro-apoptatic (Bim, Bid) molecules in hippo- without changing the amplitude, in this model of epilepsy. campal neurons [28]. Furthermore, Sargin et al.[29] have However, Epo may produce different results in different determined that early intervention with Epo prevents experimental epilepsy models, in different brain areas, with 219 BULUR, DEMİR, BAHADIR, ANKARALI ÖZMERDİVENLİ, BEYAZÇİÇEK different routes of administration, or at different treatment 13. Genc S, Koroglu TF, Genc K: Erythropoietin and the nervous system. doses. Our findings represent a first attempt to study the Brain Res, 1000, 19-31, 2004. DOI: 10.2169/internalmedicine.43.649 antiepileptic role of Epo in penicillin-induced epilepsy 14. Nadam J, Navarro F, Sanchez P, Moulin C, Georges B, Laglaine A, Pequignot JM, Morales A, Rylin P, Bezin L: Neuroprotective effects of in rats. Epo clearly decreased the frequency of penicillin- erythropoietin in the rat hippocampus after pilocarpine-induced status induced epileptiform activity in a dose-dependent manner, epilepticus. Neurol Dis, 25, 412-426, 2007. DOI: 10.1016/j.nbd.2006.10.009 without changing the amplitude of epileptiform activity. 15. Rabie T, Marti HH: Brain protection by erythropoietin: A manifold task. Phsyology (Bethesda), 23, 263-274, 2008. DOI: 10.1152/physiol.00016.2008 Further studies are needed to clarify the exact 16. Brines ML, Ghezzi P, Keenan S, Agnello D, de Lanerolle NC, Cerami mechanisms of Epo at the cellular and molecular levels in C, Itri LM, Cerami A: Erythropoietin crosses the blood-brain barrier to various experimental animal models. Epo may be the most protect against experimental brain injury. Proc Natl Acad Sci, 97, 10526- promising agent identified thus far for neuroprotection 10531, 2000. DOI: 10.1073/pnas.97.19.10526 and neuroregeneration in many neurological and 17. Uzum G, Diler AS, Bahçekapılı N, Ziylan YZ: Erythropoietin prevents the increase in blood-brain barier permeability during psychiatric conditions. pentylentetrazole induced seizures. Life Sci, 78, 2571-2576, 2006. DOI: 10.1016/j.lfs.2005.10.027 Acknowledgments 18. Kondo A, Shingo T, Yasuhara T, Kuramoto S, Kameda M, Kikuschi Y, Matsui T, Miyoshi Y, Agari T, Borlongan CV, Date I: Erythropoietin exerts This study was supported by a research project from anti-epileptic effects with the suppression of aberrant new cell formation the University of Duzce, Scientific Research Projects in the dentate gyrus and upregulation of neuropeptide Y in sizure model Department (Project Number: 2010.04.01.039 to Dr S. rats. Brain Res, 1296, 127-136, 2009. DOI: 10.1016/j.brainres.2009.08.025 DEMIR), Duzce, Turkey. 19. Chu K, Jung KH, Lee ST, Kim JH, Kang KM, Kim HK, Lim JS, Park HK, Kim M, Lee SK, Roh JK: Erythropoietin reduces epileptogenic processes following status epilepticus. Epilepsia, 49, 1723-1732, 2008. conflict of interest DOI: 10.1111/j.1528-1167.2008.01644.x 20. Liu XB, Wang JA, Yu SP, Keogh CL, Wei L: Therapeutic strategy of The authors declare that there are no conflicts of eryhropoetin in neurological disorders. CNS Neurol Disord Drug Tragets, interest. All authors approved the final manuscript. 7, 227-234, 2008. DOI: 10.2174/187152708784936617 21.Sargin D, Friedrichs H, El-Kordi A, Ehrenreich H: Erythropoietin REFERENCES as neuroprotective and neuroregenerative treatment startegy: Comprehensive overview of 12 years of preclinical and clinical research. Best Pract Res Clin Anaest, 24, 573-594, 2010. DOI: 10.1016/j. 1. Scharfman HE: The neurobiology of epilepsy. Curr Neurol Neurosci bpa.2010.10.005 Rep, 7, 348-354, 2007. 22. Sozmen SC, Hız Kurul S, Yis U, Tugyan K, Baykara B, Yılmaz 2. Shneker BF, Fountain NB: Epilepsy. Dis Mon, 49, 426-478, 2003. DOI: O: Neuroprotective effects of recombinant human erythroprotein 10.1016/S0011-5029(03)00065-8 in the developing brain of rat after lithium-pilocarpine induced 3. Fisher RS: Animal model of the epilepsies. Brain Res Rev, 14, 245-278, status epilepticus. Brain Develop, 34, 189-195, 2012. DOI: 10.1016/j. 1989. braindev.2011.05.002 4. Contreras D: Experimental models in epilepsy. Revista de Neurol, 30, 23. Wen X, Huang Y, Wang J: Erythropoietin preconditioning on 370-376, 2000. hippocampus neuronal apoptasis following status epilepticus induced 5. Garcia Garcia ME, Garcia Morales I, Matías Guiu J: Experimental by lithium-pilocarpine in rats through anti-caspase-3 expression. J Neurol models in epilepsy. Neurologia, 25, 181-188, 2010. DOI: 10.1016/S2173- India, 54, 58-63, 2006. DOI: 10.4103/0028-3886.24708 5808(10)70035-3 24. Liu X, Shen J, Jin Y, Duan M, Xu J: Recombinant human 6. Bağırıcı F, Gökçe FM, Demir S, Marangoz C: Calcium channel blocker erythropoietin (rhEPO) preconditioning on nuclear factor-kappa B flunarizine suppresses epileptiform activity induced by penicillin in rats. (NFkB) activation & proinflammatory cytokines induced by myocardial Neurosci Res Com, 28, 135-140, 2001. DOI: 10.1002/nrc.1014 ischaemia-reperfusion. Indian J Med Res, 124, 343-354, 2006. 7. Ayyildiz M, Yildirim M, Agar E, Baltaci AK: The effects of leptin on 25. Akman O, Ozkanlar YE, Ozkanlar S, Oruc E, Ulas N, Ziypak T, penicillin induced epileptiform activity in the rats. Brain Res Bulletin, Lehimcioglu NC, Turkeli M, Ucar O: Erythropoietin hormone and 68, 374-378, 2006. DOI: 10.1016/j.brainresbull.2005.09.012 ACE inhibitor protect the sperm parameters of adult male rats against 8. Gökçe FM, Bağırıcı F, Demir S, Bostancı MÖ, Güven A: The effect of doxorubicin toxicity. Kafkas Univ Vet Fak Derg, 21, 805-812, 2015. DOI: neuronal nitricoxide synthase inhibitor 7-nitroindazole on the cell death 10.9775/kvfd.2015.13412 Induced by zinc administration in the brain of rats. Turk J Med Sci, 39, 26. Genc S, Koroglu TG, Genc K: Erythropoietin as a novel neuro- 197-202, 2009. DOI: 10.3906/sag-0708-13 protectant. Restor Neurol Neurosci, 22 (2) :105-119, 2004. 9. Yildirim M, Ayyildiz M, Agar E: Endothelial nitric oxide synthase 27. Eid T, Brines M: Recombinant human erythropoietin for neuro- activity involves in the protective effect of ascorbic acid against penicillin- protection: What is the evidence? Clin Breast Cancer, 3, 109-115, 2002. induced epileptiform activity. Seizure, 19, 102-108, 2010. DOI: 10.1016/j. DOI: 10.3816/CBC.2002.s.021 seizure.2009.12.005 28. Yang J, Huang Y, Yu X, Sun H, Li Y, Deng Y: Erythropoietin 10. Kammerer M, Rassner MP, Freiman TM, Feuerstein TJ: Effects of preconditioning suppresses neuronal death following status epilepticus antiepileptic drugs on GABA release from rat and human neocortical in rats. Acta Neurobil Exp, 57, 693-702, 2009. synaptosomes. Naunyn Schmiedeberg’s Arch Pharmacol, 384, 47-57, 2011. 29. Sargin D, Hassouna I, Sperling S, Siren AL, Ehrenrich H: Uncoupling DOI: 10.1007/s00210-011-0636-8 of neurodegeneration and gliosis in a murine model of juvenile cortical 11. Loscher W: Critical review of current animal models of seizures and lesion. Glia, 57, 693-702, 2009. DOI: 10.1002/glia.20797 epilepsy used in the discovery and development of new antiepileptic 30. Won YJ, Yoo JY, Lee JH, Hwang SJ, Kim D, Hong HN: Erythropoietin is drugs. Seizure, 20, 359-368, 2011. DOI: 10.1016/j.seizure.2011.01.003 neuroprotective on GABAergic neurons against kainic acid- excitotoxicity 12. Jelkmann W: Molecular biology of erythropoietin. Intern Med, 43, in the rat spinal cell cultures. Brain Res, 1154, 31-39, 2007. DOI: 10.1016/j. 649- 659, 2004. brainres.2007.04.010 220 The Effects of Erythropoietin ... 31. Morishita E, Masuda S, Nagao M, Yasuda Y, Sasaki R: Erythropoietin 32. Gunnarson E, Song Y, Kowalewski JM, Brismar H, Brines M, Cerami receptor is expressed in rat hippocampal and cerebral cortical neurons A, Andersson U, Zelenina M, Aperia A: Erythropoietin modulation of and erythropoietin prevents in vitro glutamate-induced neuronal death. astrocyte water permeability as a component of neuroprotection. Proc Neuroscience, 76, 105-116, 1997. DOI: 10.1016/S0306-4522(96)00306-5 Natl Acad, 106, 1602-1607, 2009. DOI: 10.1073/pnas.0812708106 Kafkas Univ Vet Fak Derg KafKas Universitesi veteriner faKUltesi Dergisi 22 (2): 221-224, 2016 JoUrnal Home-Page: http://vetdergi.kafkas.edu.tr Research Article DOI: 10.9775/kvfd.2015.14205 online sUbmission: http://vetdergikafkas.org The Isolation of Dichelobacter nodosus and Identification by PCR from Ovine Footrot in Kars District, Turkey [1] Özgür ÇELEBİ 1 Salih OTLU 1 Fatih BÜYÜK 1 Celal Şahin ERMUTLU 2 Aliye GÜLMEZ SAĞLAM 1 Elif ÇELİK 1 Doğan AKÇA 3 Mitat ŞAHİN 1 [1] This study was financially supported by the Scientific Research Project Committee of Kafkas University (Project No: KAU- BAP, 2012-VF-40) 1 Department of Microbiology, Faculty of Veterinary Medicine, University of Kafkas, TR-36100 Kars - TURKEY 2 Department of Surgery, Faculty of Veterinary Medicine, University of Kafkas, TR-36100 Kars - TURKEY 3 School of Health, University of Kafkas, TR-36100 Kars - TURKEY Article Code: KVFD-2015-14205 Received: 11.08.2015 Accepted: 30.09.2015 Published Online: 30.09.2015 Abstract In this study it was aimed to isolation and identification by PCR of specific agent from ovine footrot in Kars district and thus determination of prevalence of disease. To this end, 8,970 sheep belong to 10 different flocks were examined clinically, and in 1532 of these (17.07%) were found lameness for various reasons. Out of 247 (2.75%) of these cases were evaluated to be footrot suspect clinically. Bacteria were isolated in 205 (82.99%) of the 247 samples that were cultured in an anaerobic environment due to the suspicion of footrot. When Gram stains and microscopic investigation was carried out on these isolates, 195 of them (95.12%) were found to be Gram negative rod-type bacteria. These isolates were subjected by polymerase chain reaction (PCR) using Dichelobacter nodosus specific primer and amplicons (440bp) of expected weight in 153 (78.46%) of isolates were found. Considering of these findings, it was concluded that prevalence of disease is high in sheep in Kars district. Keywords: Sheep, Footrot, Dichelobacter nodosus, Isolation, PCR Kars Yöresi Koyunlarında Piyeten Olgularından Dichelobacter nodosus İzolasyonu ve PCR İle İdentifikasyonu Özet Bu araştırmada, Kars yöresinde footrotlu koyunlardan hastalığın spesifik etkenin izolasyonu, PCR ile identifikasyonu ve böylece hastalığın prevalansının saptanması amaçlanmıştır. Bu amaçla 10 farklı sürüye ait 8970 koyun klinik olarak incelenmiş 1532’sinde (%17.07) çeşitli nedenlere bağlı topallık görülmüştür. Bunlardan 247’si (%2.75) klinik açıdan footrot şüpheli olarak belirlendi. Footrot şüphesiyle anaerobik ortamda kültürel olarak değerlendirilen 247 örneğin 205 inde (%82.99) bakteriyel izolasyon gerçekleştirilmiş, izolatların yapılan Gram boyama ve mikroskobik incelenmeleri sonucu bunların 195’i (%95.12) Gram negative çomak morfolojisinde bakteriler olarak görülmüştür. Bu izolatlar Dichelobacter nodosus’a spesifik primer kullanılarak polymerase chain reaction (PCR) a tabi tutulmuş ve 153’ünde (%78.46) beklenen ağırlıkta (440 bp) amplikonlar saptanmıştır. Bu bulgular dikkate alındığında, Kars yöresindeki koyunlarda hastalığın prevalansının yüksek olduğu sonucuna varılmıştır. Anahtar sözcükler: Koyun, Piyeten, Dichelobacter nodosus, İzolasyon, PCR INTRODUCTION by the separation of keratinous hoof from the underlying tissue resulting in severe lameness, degraded body Footrot is a specific contagious disease of sheep and condition and reduced wool production [1,2]. D. nodosus is a goats, although it has been reported in cattle, horses, pigs, rod shaped, Gram-negative, obligate anaerobic bacterium deer and mouflon. It is an infectious syndrome caused that has proteases and keratinases that are able to dissolve by synergistic action, where Dichelobacter nodosus is the sheep hooves [3,4]. The primary predisposing factors for main transmitting agent. Ovine footrot is characterized disease include environmental conditions as well as the  İletişim (Correspondence)  +90 474 2426836, Ext. 5136 Fax: +90 474 2426853  ozgurcelebi36@hotmail.com 222 The Isolation of Dichelobacter ... host’s genetics, immunity, diet and stocking rates [5,6]. Clinical Investigation and Sampling Method Although footrot is widespread in many areas of the Of the 8.970 sheep that were evaluated from 10 world where sheep are raised, it is particularly prevalent different herds, 1.532 of them were found to have lameness in temperate, rainy regions such as the UK, Australia for various reasons. These sheep were analysed with the and New Zealand [7]. Reports have been made in many scoring system recommended by Egerton and Roberts [9] countries regarding the disease’s aetiology, pathogenesis, for footrot lesions. Those sheep with a lesion score of 2 epidemiology, treatment, control and eradication. Turkey (interdigital dermatitis) to 4 (severe interdigital dermatitis ranks seventh in the world with regard to sheep population. and under-running of the hard horn of the hoof) were There are approximately 31 million sheep in Turkey, suspected to have footrot, and samples were collected and 1.49% of them are raised in the region of Kars [8]. from these 247 sheep using sterile cotton swab. These Approximately 70% of the people in Kars province work in samples were transferred to a Stuart Transport Medium the area of farming and animal husbandry. More than 90% (Oxoid CM0111) [10], rapidly transported to the laboratory of the sheep raised in the region are from the Morkaraman with an unbroken cold chain, and then immediately and Akkaraman breeds. Outside of the winter months, the evaluated. sheep spend a bit more than half the year (from April to November) grazing in pastures. The animal owners and Isolation shepherds have very little knowledge or interest in foot All of the samples were cultured by streaking them in diseases, so they do not conduct immunization, foot baths Eugon agar (BD Bacto, Sparks, MD, USA) and trypticase- or hoof care. Furthermore, the government does not carry arginine-serine agar (TAS) [11]. To assist in the growth out any program to inform farmers about the disease of Dichelobacter spp. colonies, 5% defibrinated sheep’s or control and eradicate it. The goal of this study was to blood was added to the mediums. After the plates were establish the status of footrot in sheep in the region of streaked, they were incubated at 37°C for 4-5 days in a 2.5 Kars, isolate the agent and identify using PCR. The study liter jar (Merck) using an Anaerogen kit (Oxoid) to ensure did not take into consideration the breed, age and diet anaerobiosis. Afterward, if the Gram stain and microscopic of the sheep or environmental factors such as rainfall, characteristics of the colonies that grew were similar to D. moisture and type of terrain. nodosus [12], passage was performed onto Eugon agar. MATERIALS and METHODS DNA Extraction of Bacterial Cultures Reference Bacterial Strain Standard methods were used to extract DNA from the bacteria colonies. Using a sterile toothpick, selected The reference strain of D. nodosus (ATCC 25549) was colonies of D. nodosus cells were prepared in 1.5 ml obtained from the Leibniz-Institut DSMZ-German Collection microcentrifuge tubes in 100 µl of sterile phosphate of Microorganisms and Cell Cultures (Braunschweig, buffered saline (PBS). The tubes were placed in a boiling Germany). water bath for 10 min, cooled on ice for 5 min and centrifuged at 13.000 x g for 10 min. One microliter of the Study Region, Period and Sampling supernatant was used for PCR. This study was conducted on sheep raised in Kars Detecting the fimA Gene of D. nodosus Using PCR province, which is in the Northeast Anatolia region of Turkey. The study was conducted on 8.970 sheep from The primers (Table 1) and PCR settings used to identify 10 herds (herd size ranged from 800 to 1.100) grazing at the fimA gene of Dichelobacter nodosus were chosen various locations in the region from April 2013 to October according to Cagatay and Hickford [13]. A standard strain 2014 (the pasture grazing period). obtained from DSMZ was used for a positive control, Table 1. Primers used to amplify the fimA gene region of Dichelobacter nodosus Tablo 1. Dichelobacter nodosus’un fimA gen bölgesinin amplifikasyonunda kullanılan primerler Primer Sequence (5ʹ→3ʹ) Serogroup Specificity Forward U1 ATCCCTGCATACAACGACTACAT A, B, C, E, F, G, I and M (class I) U2 GC TATTC CACAATAC CAAAACTACAT D and H (classII) Reverse D1 AC TCAAGAGAGAGGC TTTTAAGTAAG B, C, G, E and M D2 AGAGAGGCTTTCACATTTAAGAGC A, F, I, E and M D3 GTAC CGAAGTA CAC C TTTGATTG D and H 223 ÇELEBİ, OTLU, BÜYÜK, ERMUTLU GÜLMEZ SAĞLAM, ÇELİK, AKÇA, ŞAHİN while sterile distilled water was used for a negative the D. nodosus fimA gene was identified in 153 of them control. (78.46%) (Fig. 1). Analysis of the PCR Products DISCUSSION The PCR products were electrophoresed in 1% agarose gels, stained with nucleic acid stain (Safeview, NBS The disease of footrot in sheep is economically Biologicals Ltd) and visualized under UV illumination (UVP significant because it causes lameness, weight loss and LMS-20E, Upland, CA, USA) and then photographed. wool production loss to various degrees in many countries around the world where sheep are raised. The prevalence RESULTS of the disease has been reported at 12.54% [2] and 16.41% in Kashmir, India [14], 10% in the United Kingdom [15] and 3.1% in Bhutan [16]. Clinical Examination Turkey is divided into seven different geographical An evaluation was performed on 8.970 sheep from 10 regions based on climactic conditions and altitude. In spite flocks, and 1.532 of the sheep (17.07%) were found to have of this variety of geography, there are very few studies that lameness for various reasons. The cause of lameness in isolate and identify the agent for ovine footrot due to the the majority of the cases was hoof horn deformities, and clinical footrot was found to be the cause in 247 of these difficulty of culturing many of the microbes that cause foot cases (16.12%). When compared to all of the sheep that diseases in cloven hoof animals (anaerobiosis, fragility, [17] were clinically evaluated in the study, the prevalence of mixed infection etc.) . Previous studies have been largely footrot was found to be 2.75%. focused on the healing effects of different diagnosis and treatment options using clinical radiological imaging. Isolation Results In a study that conducted a clinical and radiological investigation of 9.052 sheep in the Burdur region (an area Bacteria were isolated in 205 (82.99%) of the 247 in Turkey’s Mediterranean region) during the sheep pen samples that were subjected to a bacterial culture in an and pasture seasons in order to analyse the distribution anaerobic condition because footrot was suspected. When and environmental factors of foot diseases in sheep, Avki Gram stains and microscopic investigation was carried et al.[18] found that 1.576 animals (16.30%) had foot disease, out on these isolates, 195 of them (95.12%) were found to that 13.46% of these diseases were hoof deformities, and be Gram negative rod-type bacteria. These isolates were that 2.55% of them were ovine footrot. In another study subjected to PCR because D. nodosus was suspected. that conducted a clinical and radiological evaluation of PCR Detection of the fimA Gene foot diseases observed in sheep raised in the regions of Kars and Iğdır [19]; 4,230 sheep were examined in the Of the 195 potential isolates that were subjected to a pasture season and 3.770 were examined in the pen/stall PCR, a 440-bp amplicon that was of the expected size for period for a total of 3.770 sheep. Foot disease was found in 1.080 (25.51%) and 520 (13.76%) sheep, respectively. Hoof horn deformities were the most prevalent in both seasons, while the prevalence of footrot was found to be 2.83% in the pasturing period and 0.82% in the pen/stall period. This study evaluated 8.970 sheep from 10 flocks being raised in various parts of Kars province, and 1.532 of them (17.07%) were found to have lameness for various reasons. The cause of lameness in the majority of the cases was hoof horn deformities, while clinical footrot was found to be the cause of lameness in 247 of these cases (16.12%). When compared to all of the sheep that were clinically evaluated in the study, the prevalence of footrot was found to be 2.75%. This percentage was lower than some of the aforementioned studies [2,14,15] but quite close to the results of other studies [16,19]. It is known that some factors related Fig 1. Specific PCR products of Dichelobacter nodosus from clinical to the host animal (such as breed and immunity) as well samples of sheep with footrot. Lane M: 100 bp DNA marker, lane 1: as certain environmental factors (such as rain, temperature positive control, lane 2: negative control, lane 3-14: D. nodosus positive samples and moisture) have an effect on the natural progression Şekil 1. Piyetenli koyunlara ait klinik örneklerden izole edilen of the disease. For example, the average annual rainfall in Dichelobacter nodosus spesifik PCR ürünleri. M: 100 bp DNA marker, the UK and India is much higher than that of Kars province, 1: pozitif kontrol, 2: negative kontrol, 3-14: D. nodosus pozitif örnekler while Bhutan’s average annual rainfall is quite similar to 224 The Isolation of Dichelobacter ... this area. The prevalence figures obtained in this study anaerobe.2011.02.003 prove that atmospheric conditions such as rainfall, 3. Bennett G, Hickford J, Sedcole R, Zhou H: Dichelobacter nodosus, temperature and moisture have a definite effect on the Fusobacterium necrophorum and the epidemiology of footrot. Anaerobe, progression of the disease. 15, 173-176, 2009. DOI: 10.1016/j.anaerobe.2009.02.002 4. Raadsma HW, Egerton JR: A review of footrot in sheep: Aetiology, risk Isolating D. nodosus is an extremely difficult and time factors and control methods. Livest Sci, 156,106-114, 2013. DOI: 10.1016/j. livsci.2013.06.009 consuming process, partly because of the fastidious 5. Winter AC: Footrot control and eradication (elimination) strategies. nature of this strict anaerobe, but also because of the large Small Rumin Res, 86, 90-93, 2009. DOI: 10.1016/j.smallrumres.2009.09.026 number of different bacteria in the microflora of the footrot 6. Bennett G, Hickford JGH: Ovine footrot: New approaches to an old lesion [20,21]. Furthermore, taking samples correctly and disease. Vet Microbiol, 148, 1-7, 2011. DOI: 10.1016/j.vetmic.2010.09.003 quickly transporting them to the laboratory under suitable 7. Stewart DJ: Footrot of sheep. In, Egerton JR, Yong WK, Riffkin GG (Eds): conditions is absolutely crucial to obtain an accurate Footrot and Foot Abscess of Ruminants. 5-45, CRC Press Inc., Boca Raton, isolation rate. Bacteria were isolated in 205 (82.99%) of FI, 1989. the 247 samples that were cultured under anaerobic 8. TUIK: Turkish Statistical Institute report on livestock production of conditions due to suspicion of footrot. This isolation Turkey, 2014. http://www.tuik.gov.tr/PreHaberBultenleri.do?id=18851; Accessed: 29.09.2015. rate can be affected by how the samples are taken and 9. Egerton JR, Roberts DS: Vaccination against ovine footrot. J Com transported to the laboratory, the streaking stages and the Pathol, 81, 179-185, 1971. DOI: 10.1016/0021-9975(71)90091-0 incubation conditions. When Gram stains and microscopic 10. Egerton JR, Parsonson IM: Isolation of Fusiformis nodosus from cattle. investigation were carried out on the isolates, 195 of Aust Vet J, 42, 425-429, 1966. DOI: 10.1111/j.1751-0813.1966.tb04646.x them (95.12%) were found to be Gram negative rod-type 11. Thorley CM: A simplified method fort he isolation of Bacteroides bacteria. These isolates were subjected to PCR because D. nodosus from ovine footrot and studies on its colony morphology and nodosus was suspected. Of the 195 isolates subjected to serology. J Appl Bacteriol, 40, 301-309, 1976. DOI: 10.1111/j.1365- 2672.1976.tb04178.x PCR, 153 (78.46%) of them were found to be D. nodosus. 12. Quinn PJ, Carter ME, Markey BK, Carter GF: Non-spore-forming It is known that cases with ovine footrot feature bacterial anaerobic bacteria. In, Quinn PJ (Ed): Clinical Veterinary Microbiology. complexity [6] and that Fusobacterium necrophorum has a 184-190, Mosby Press, London, 2004. synergistic effect in the formation of the lesions [3,22]. This 13. Cagatay IT, Hickford JGH: Uptade on ovine footrot in New leads to the conclusion that the isolates that could not be Zealand: Isolation, identification, and characterization of Dichelobacter identified as D. nodosus may be other agents that are part nodosus trains. Vet Microbiol, 111, 171-180, 2005. DOI: 10.1016/j. vetmic.2005.09.010 of the aetiology of the disease. 14. Farooq S, Wani SA, Hussain I, Bhat MA: Prevalence of ovine footrot This was the first study to be conducted to establish in Kashmir, India and molecular characterization of Dichelobacter nodosus by PCR. Indian J Anim Sci, 80, 826-830, 2010. the status of footrot in sheep from the region of Kars, 15. Wassink GJ, Grogono-Thomas R, Moore IJ, Green IE: Risk factors isolation the agent and identify it with PCR. The results associated with the prevalence of footrot in sheep from 1999 to 2000. Vet have shown that the disease is significantly prevalent in Rec, 152, 351-358, 2003. DOI: 10.1136/vr.152.12.351 the sheep of the region and D. nodosus was isolated and 16. Gurung RB, Tshering P, Dhungyel OP, Egerton JR: Distribution and identified in a high percentage of the subjects. The goal prevalence of footrot in Bhutan. Vet J, 171, 346-351, 2006. DOI: 10.1016/j. of subsequent studies should be to identify the serogroup tvjl.2004.11.012 and serotypes of the strains of D. nodosus that are isolated. 17. Ozgen EK, Cengiz S, Ulucan M, Okumus Z, Kortel A, Erdem H, This is necessary in order to develop a vaccination against Sarac HG: Isolation and identification of Dichelobacter nodosus and Fusobacterium necrophorum using the polymerase chain reaction method the disease. In view of the disease’s infectiousness and in sheep with footrot. Acta Vet Brno, 84, 97-104, 2015. DOI: 10.2754/ economic impact, it is critically important that a range avb201584020097 of programs and activities be carried out, including 18. Avki S, Temizsoylu D, Yiğitarslan K: Prevalence of foot diseases in vaccination, hoof care, foot baths, evaluating the effects sheep at Burdur province and evaluation of environmental factors. Vet of environmental factors on the disease, separating sick Cerrahi Derg, 10, 5-12, 2004. animals from healthy ones, treating sick animals as soon as 19. Baran V, Yayla S, Kılıç E, Özaydın İ, Aksoy Ö, Ermutlu CS: The effects of pasture characteristics and seasonal differences on sheep foot possible, and training sheep ranchers about these topics. diseases: A field study on the Kars and Iğdır Regions - Turkey. Kafkas Univ Vet Fak Derg, 21, 377-382, 2015. DOI: 10.9775/kvfd.2014.12526 REFERENCES 20. Gradin JL, Schmithz JA: Selective medium for isolation of Bacteroides nodosus. J Clin Microbiol, 6, 298-302, 1977. 1. Wani SA, Samanta I: Current understanding of the aetiology and 21. Rood JI, Howarth PA, Haring V, Billington SJ, Yong WK, Liu D, laboratory diagnosis of footrot. Vet J, 171, 421-428, 2006. DOI: 10.1016/j. Palmer MA, Pitmani DR, Links I, Stewart DJ, Vaughan JA: Comparison tvjl.2005.02.017 of gene probe and conventional methods for the differentiation of bovine 2. Rather MA, Wani SA, Hussain I, Bhat MA, Kabli ZA, Magray SN: footrot isolates of Dichelobacter nodosus. Vet Microbiol, 52, 127-141, 1996. Determination of prevalence and economic impact of ovine footrot DOI: 10.1016/0378-1135(96) 00054-5 in central Kashmir India with isolation and molecular characterization 22. Winter AC: Lameness in sheep. Small Rumin Res, 76, 149-153, 2008. of Dichelobacter nodosus. Anaerobe, 17, 73-77, 2011. DOI: 10.1016/j. DOI: 10.1016/j.smallrumres.2007.12.008 Kafkas Univ Vet Fak Derg KafKas Universitesi veteriner faKUltesi Dergisi 22 (2): 225-232, 2016 JoUrnal Home-Page: http://vetdergi.kafkas.edu.tr Research Article DOI: 10.9775/kvfd.2015.14229 online sUbmission: http://vetdergikafkas.org Effect of Piggery Microclimate on Ejaculate Performance of Artificial Insemination Boars Dariusz KOWALEWSKI 1 Stanisław KONDRACKI 2 Krzysztof GÓRSKI 2 Magdalena BAJENA 3 Anna WYSOKIŃSKA 2 1 Animal Breeding and Insemination Centre in Bydgoszcz, Zamczysko 9a, 85-868 Bydgoszcz - POLAND 2 Siedlce University of Natural Sciences and Humanities, Department of Bioengineering and Animal Husbandry, Faculty of Natural Sciences, Prusa 14, 08-110 Siedlce - POLAND 3 Animal Breeding and Reproduction Centre Ltd. in Łowicz, Topolowa 49, 99-400 Łowicz - POLAND Article Code: KVFD-2015-14229 Received: 13.08.2015 Accepted: 25.11.2015 Published Online: 02.12.2015 Abstract The study was carried out on 1913 ejaculates collected from 51 Landrace boars. The ejaculates were collected manually. The study included all ejaculates collected by one artificial insemination station over a span of 12 consecutive months. The ejaculates were subjected to the standard analysis which involved: ejaculate volume, sperm concentration, percentage of progressive motility spermatozoa, total number of spermatozoa, and number of artificial insemination doses per ejaculate. Temperature, relative air humidity, and atmospheric pressure in the piggery were monitored during the semen collections. The resulting data were grouped by air temperature, humidity and pressure, and analyzed. It has been found that the microclimate in the place of semen collection may affect the quality of the collected semen. This effect is varied; temperature, humidity and atmospheric pressure act differently in relation to the semen traits. Temperature and atmospheric pressure have an effect on sperm concentration. Ejaculates with the highest sperm concentrations were collected at the lowest measured temperatures (10°C and lower) as well as with the lowest relative air humidity. Sperm motility revealed a strict and oriented relationship with both temperature and humidity, but also with atmospheric pressure. Semen collected at the lowest air humidity (50% and lower) and at the lowest observed atmospheric pressure (below 900 hPa) contained the most sperm. The highest number of artificial insemination doses are produced from ejaculates collected in such conditions. Keywords: Microclimate, Semen quality, Artificial insemination boars Mikro Klima İklim Şartlarının Erkek Damızlık Domuzlardaki Ejekulasyon Kalitesine Etkileri Özet Araştırma Landrace cinsi 51 erkek damızlık domuzdan alınan 1913 ejekulasyonda gerçekleştirilmiştir. Numuneler el yöntemiyle alınmıştır. Ejekulasyonlar sonraki 12 ay süresince uygulanacak yapay döllenme için tek bir domuz yetiştirme istasyonundan elde edilmiştir. Standart tahliller olan, semen hacmi, spermlerin konsantrasyonu, hareketli sperm sayısının oranı, toplam sperm sayısı ve yapay döllenmedeki doz sayısı analizleri yapılmıştır. Semen örneği alımı sırasında damızlık hayvanların bulundupu yerdeki atmosfer basıncı, havadaki nem ve sıcaklık durumu izlenmiştir. Elde edilen veriler, sıcaklık, nem ve hava basıncına göre gruplandırılmış vede tekrar analiz edilmiştir. Bu çalışmalar neticesinde damızlık hayvanların tutulduğu yerdeki mikro klima şartlarının semen kalitesine etkisi olabileceği görülmüştür. Sıcaklık, nem ve atmosfer basıncı sperm özelliklerine farklı biçimde etki etmektedir. Sıcaklık ve atmosfer basıncı spermlerin konsantrasyonunu doğrudan etkilemektedir. En yüksek sperm konsantrasyonu bulunan ejekulasyonlar, havaya göre en düşük nem ortamı vede en düşük sıcaklıkta (10°C ve aşağısı) elde edilmiştir. Sperm motilitesinin hava basıncı, nem ve sıcaklığa doğrudan bağlı olduğu ortaya çıkmıştır. En fazla sayıda sperm miktarı, en düşük nem oranlarında yani %50 ve daha azı ile 900 hPa hava basıncı şartlarında sağlanmıştır. Bu şartların hakim olduğu ortamlarda hayvanlardan alınan ejakulasyonlardan yapay döllenmeler için gerekli en fazla sayıda elde edilmiştir. Anahtar sözcükler: Mikroklima, Sperm kalitesi, Damızlık erkek domuz INTRODUCTION enables an efficient use of sires, facilitates the organization of breeding in the herd, and reduces the risk of spreading Artificial insemination (AI) plays an important role in infectious diseases [1]. The main criterion of boars selection swine production and brings numerous advantages; it for AI centers is the breeding value of the boar, which  İletişim (Correspondence)  +48 25 6431378; Fax: +48 25 6431272  gorki@uph.edu.pl 226 Effect of Piggery Microclimate ... is usually much higher than the average of a given a clean semen collecting flask that filters out gel, dust, population of young boars classified for evaluation [2]. and bristles [16]. The evaluation included all ejaculates The economic viability of an AI boar does not depend collected over the period of 12 consecutive months. In much on its breeding value though. The decisive factor order to evaluate the effect of the facility microclimate is the ejaculatory performance, which is the number of AI on the semen quality, each ejaculate was subjected to doses obtained per ejaculate. It is important that the boar standard analysis of the following physical traits: ejaculate shows the ability to produce ejaculates of rather equal volume, sperm concentration, percentage of spermatozoa quality throughout its lifetime [3]. Therefore, the aim is to showing progressive motility, the total number of use the boars that demonstrate outstanding ejaculate spermatozoa, and the number of insemination doses per traits, i.e. a large volume of discharged semen with a high ejaculate. Ejaculate volumes were determined by weight, concentration and good motility of sperm [4]. without the gelatinous fraction, using electronic scales. Sperm concentration in the ejaculates was determined Numerous studies demonstrate that the quality and with a photometric method, using a spectrophotometer quantity of semen depend on a complexity of factors. (IMV Technologies, France). Sperm motility was evaluated These include genetics, primarily the breed of the boar [5,6]. with a Nikon Eclipse 50i light microscope equipped with a Crossbred boars, which attain sexual maturation sooner, heated stage. A sample of 5 µl of sperm suspension was grow faster and have a better breeding performance, placed on a pre-warmed slide and sealed with a coverslip as compared with pure-bred pigs, have found a wide at 37ºC. Under 200x magnification, the percentage of application in artificial insemination [7]. Other than genetic normally motile spermatozoa was determined in the factors also affect boar performance, and these include overall number of sperms present in the field of vision of boar’s age [8], year season [9,10], changing photoperiod [11], the microscope. The total number of motile spermatozoa feeding [12], as well as the time interval between and the number of insemination doses per ejaculate were ejaculations [13]. It has been found that ejaculation calculated using SYSTEM SUL (v. 6.35; Gogosystem, Poland) performance in boars is also related with the size of the software package. testes [14]. Such a variety of genetic and environmental factors, as well as interactions between them, result in In order to evaluate the effect of air temperature, extremely varied ejaculates of AI boars, which complicates ejaculates were assigned to the following four groups: their efficient management. This study is an attempt to Group I : Ejaculates collected at a temperature up to 10°C evaluate the effect of air temperature, relative humidity, and atmospheric pressure during semen collection on the Group II : Ejaculates collected at a temperature 11-15°C physical traits of ejaculates of artificial insemination boars. Group III : Ejaculates collected at a temperature 16-20°C Group IV : Ejaculates collected at a temperature above 20°C MATERIAL and METHODS In order to evaluate the effect of air relative humidity, All boars were fed commercial food for AI boars and the ejaculates were assigned to the following six groups: were housed in individual pens equipped with nipple Group I : Ejaculates collected at an air humidity up to 50% drinkers. The boars were maintained in accordance with Group II : Ejaculates collected at an air humidity 51-55% the principles of animal welfare [15]. Ethics committee approval for this study was given by the Decision of the Group III : Ejaculates collected at an air humidity 56-60% District Veterinary Officer (14262001). In the study air Group IV : Ejaculates collected at an air humidity 61-65% temperature, relative humidity and the atmospheric Group V : Ejaculates collected at an air humidity 66-70% pressure on the moment of semen collection were Group VI: Ejaculates collected at an air humidity above 70% measured. Temperature and humidity was recorded using a thermo-hygrometer TERMIK PLUS (1000209, Termo- In order to evaluate the effect of atmospheric pressure, produkt, PL). Temperature was measured with a precision the ejaculates were assigned to the following six groups: of one degree Celsius. Humidity, expressed as a percentage, was measured with a precision of one percent point. Group I: Ejaculates collected at an atmospheric pressure up Atmospheric pressure was measured using an barometer to 990 hPa ADLER (Bar 003, Demus, PL) with a resolution one hPa. Group II: Ejaculates collected at an atmospheric pressure 991- 995 hPa The temperature and humidity sensors, as well as the barometer, were placed in the central part of the Group III: Ejaculates collected at an atmospheric pressure piggery, halfway in the aisle dividing the facility into two 996-1000 hPa equal parts. The readings were taken during the semen Group IV: Ejaculates collected at an atmospheric pressure collection from each boar. The analysis included 1913 1001-1005 hPa ejaculates obtained from 51 Landrace boars. The semen Group V: Ejaculates collected at an atmospheric pressure was collected using the gloved-hand technique, using 1006-1010 hPa 227 KOWALEWSKI, KONDRACKI, GÓRSKI BAJENA, WYSOKIŃSKA Group VI: Ejaculates collected at an atmospheric pressure The data of Table 1 reveal that the ejaculates of Group above 1010 hPa II had the lowest ejaculate volume (P<0.01). Ejaculates collected at temperature up to 10°C (Group I) showed a The resulting data were processed statistically according higher sperm concentration by 19 x103/mm3 compared to the following model: with those collected at 11°C or higher (Groups II-IV, P<0.01). Yij = μ + ai + eij The data shown in Table 1 indicate a distinct relationship where: between motility and air temperature at semen collection. Sperm motility in ejaculates increased with air temperature Yij - factor level, they were collected at. The highest sperm motility was μ - population mean, found in ejaculates collected at temperature above 16°C ai - effect of air temperature, humidity or atmospheric (Groups III and IV). It exceeded 72.75% and was by more pressure, than 1.5% higher than in the semen collected at 11-15°C e - error. (P<0.01) and by more than 2.7% higher compared to those ij collected below 10°C (P<0.01). The significance of differences between the groups was tested using the Tukey test. No clear relationship has also been found between the number of insemination doses and air temperature at semen collection (Fig. 1). The average was approx. 24.61-25.05 RESULTS insemination doses obtained from an ejaculate (Groups I, III and IV), but Group II (11-15ºC) was an exception; these Table 1 presents the data on physical characteristics ejaculates gave by more than 1.5 fewer doses (P<0.05). of the ejaculates in relation to air temperature measured at semen collection. The data reveal that nearly 70% of Table 2 presents data on the physical characteristics of ejaculates were collected at the range 11-20°C. ejaculate, depending on the relative humidity recorded Table 1. Relationship between ejaculate physical characteristics and air temperature in the piggery during ejaculate collection Tablo 1. Ejakulat toplanması esnasında domuz ahırındaki hava sıcaklığı ile ejakulatın fiziksel özellikleri arasındaki ilişki Air Temperature in the Piggery (°C) (Groups) Specification I (≤10°C) II (11-15°C) III (16-20°C) IV (>20°C) Average air temperature during ejaculates collection (ºC) 9.05 12.89 18.17 22.54 Number of ejaculates n 409 747 564 193 Ejaculate volume (ml) X±Sx 241.93±86.78B 234.71±75.36A 243.63±84.72B 244.00±84.34B Sperm concentration (x 103/mm³) X±Sx 398.56±103.98B 375.33±94.14A 379.49±90.55A 378.86±95.26A Percentage of spermatozoa with progressive A AB motility (%) X±Sx 70.00±0.00 71.23±3.29 72.77±4.48 B 72.75±4.47B Total sperm count per ejaculate (x 109) X±Sx 64.09±20.23b 60.82±19.79a 64.16±18.97b 64.4420.41b Number of insemination doses X±Sx 24.61±7.97b 23.97±7.58a 25.05±7.15b 24.82±7.58b a,b Differences between average values, represented by different letters in the same row, is important (P<0.05); A,B Differences between average values, represented by different letters in the same row, is important (P<0.01) Fig 1. Monthly distribution of temperatures during semen collection (number of days in each month when semen was collected at a specific temperature) Şekil 1. Semen toplanması boyunca sıcak- lığın aylara göre dağılımı (belli bir sıcaklıkta semen toplandığında her aydaki günlerin sayısı) 228 Effect of Piggery Microclimate ... Table 2. Relationship between ejaculate physical characteristics and air relative humidity in the piggery during ejaculate collection Tablo 2. Ejakulat toplanması esnasında domuz ahırındaki nem ile ejakulatın fiziksel özellikleri arasındaki ilişki Air Relative Humidity in the Piggery (%) (Groups) Specification I (≤50%) II (51-55%) III (56-60%) IV (61-65%) V (66-70%) VI (>70%) Average air relative humidity during ejaculates collection (%) 44.52 53.32 58.44 63.58 68.62 172 Number of ejaculates n 446 395 437 325 138 172 Ejaculate volume (ml) X±Sx 230.90±79.43A 233.93±83.35AB 250.17±80.34C 238.73±82.30B 251.96±82.23C 242.52±82.04BC Sperm concentration (x 103/mm³) X±Sx 412.91±96.94 C 382.48±95.63B 367.73±89.39AB 378.09±95.15B 351.23±87.44A 367.67±96.60AB Percentage of spermatozoa with X±Sx 71.14±3.19A 71.65±3.71B Aprogressive motility (%) 71.17±3.21 71.85±3.89 B 72.32±4.24B 72.44±4.31B Total sperm count per ejaculate (x 109) X±Sx 65.22±20.72c 61.51±20.82ab 62.66±18.33ab 62.52±19.66ab 60.59±16.98ab 62.95±20.21ab Number of insemination doses X±Sx 25.06±8.15 24.15±7.68 24.46±7.05 24.55±7.62 24.23±6.42 24.22±7.58 a,b Differences between average values, represented by different letters in the same row, is important (P<0.05); A,B Differences between average values, represented by different letters in the same row, is important (P<0.01) Fig 2. Monthly distribution of relative humidities during semen collection (number of days in each month when semen was collected at a specific humidity) Şekil 2. Semen toplanması boyunca nemin aylara göre dağılımı (belli bir nemde semen toplandığında her aydaki günlerin sayısı) during the collection. These data show that ejaculates of was found between the number of insemination doses and the greatest volume were collected at a relative humidity air relative humidity. The average number of insemination of 66-70%. The volume exceeded 251 ml and was higher doses obtained from the ejaculate was about 24.15-25.06 by 21.06 ml than in those collected at a humidity not (Fig. 2). exceeding 50% (P<0.01) and by more than 18 ml higher than in those collected at a relative humidity of 51-55% Table 3 presents the data on physical traits of the (P<0.05). Ejaculates collected at a relative humidity equal semen in relation to the atmospheric pressure measured or lower than 50% (Group I) had a higher concentration at the moment of ejaculation. Group VI, with the highest of sperm, by 30 x103/mm3, as compared with ejaculates atmospheric pressure, was found to have the lowest collected at a relative humidity of 51% or higher (Groups ejaculate volume. It exceeded 232 ml and was by about II, III, IV, V and VI; P<0.01). 10.3 ml less than those collected at 991-995 hPa (P<0.01) and by about 11.5 ml less than in ejaculates collected at The highest sperm motility was found in ejaculates 1001-1005 hPa (P<0.01). collected at a relative humidity above 70%. It exceeded 72.4% and was higher by more than 1.27% compared Ejaculates collected at the lowest atmospheric pressure to those collected at 56-60% (P<0.01) and by 1.3% (not more than 990 hPa, Group I) had the highest sperm higher than in those collected at a relative humidity not concentration. The concentration of sperm decreased as exceeding 50% (P<0.01). Ejaculates collected at very atmospheric pressure increased to 996-1000 hPa (Group low relative humidities (below 50%) contained the most III). Ejaculates collected in this group had the lowest sperm sperm. Sperm counts in these ejaculates averaged 65.22 concentration, by about 21 x103/mm3 less than those billion, by 2.27-4.63 billion more than in those collected at collected at a pressure below 990 hPa (P<0.05). A further higher humidity (Group II, III, IV, V and VI). No relationship increase in atmospheric pressure resulted in an increase 229 KOWALEWSKI, KONDRACKI, GÓRSKI BAJENA, WYSOKIŃSKA Table 3. Relationship between ejaculate physical characteristics and atmospheric pressure in the piggery during ejaculate collection Tablo 3. Ejakulat toplanması esnasında domuz ahırındaki atmosferik basınç ile ejakulatın fiziksel özellikleri arasındaki ilişki Atmospheric Pressure in the Piggery (hPa) (Groups) Specification I II III IV V VI ≤990 hPa 991-995 hPa 996-1000 hPa 1001-1005 hPa 1006-1010 hPa >1010 hPa Average atmospheric pressure during ejaculates collection (hPa) 981.56 993.26 998.61 1004.10 1007.87 1015.35 Number of ejaculates n 137 153 316 632 474 201 Ejaculate volume (ml) X±Sx 239.90±84.21B 242.63±84.22BC 234.67±77.32AB 243.83±83.77C 240.16±81.52BC 232.32±78.13A Sperm concentration (x 103/mm³) X±Sx 395.69±95.09 c 380.78±101.25ab 374.87±97.78a 376.82±94.90a 385.34±94.00b 392.04±94.52bc Percentage of spermatozoa A B B B B with progressive motility (%) X±Sx 70.00±0.00 71.05±3.07 71.52±3.59 71.99±4.00 71.48±3.55 72.04±4.04 B Total sperm count per ejaculate (x 109) X±Sx 64.07±19.87 b 62.65±19.86ab 59.94±19.11a 63.46±20.20b 63.45±19.10b 63.60±20.62b Number of insemination doses X±Sx 25.23±8.56b 24.94±7.90a 23.83±6.79a 24.41±7.54a 24.83±7.30a 24.97±8.17a a,b Differences between average values, represented by different letters in the same row, is important (P<0.05); A,B Differences between average values, represented by different letters in the same row, is important (P<0.01) Fig 3. Monthly distribution of air pressure during semen collection (number of days in each month when semen was collected at a specific pressure) Şekil 3. Semen toplanması boyunca hava basıncının aylara göre dağılımı (belli bir hava basıncında semen toplandığında her aydaki günlerin sayısı) in the concentration of sperm in the ejaculate. The data in DISCUSSION Table 3 show there is a dependence of sperm motility on atmospheric pressure at ejaculation. As the atmospheric The resulting data suggest that the characteristics of pressure increased, motility in the ejaculates increased too. ejaculates depend on the piggery microclimate para- The highest level of sperm motility was found in ejaculates meters present during semen collection. The highest collected at atmospheric pressure above 1010 hPa. Motile sperm concentration was found in ejaculates collected sperm rate exceeded 72% and was higher by 0.99% than in at low air temperatures, below 10°C. Moreover, ejaculates ejaculates collected at 991-995 hPa (P<0.01) and by 2.04% collected at lower temperatures had a good volume. It higher than in those collected at atmospheric pressure not seems that boars do not have a particular susceptibility exceeding 990 hPa (P<0.01). to low air temperatures during ejaculation. Low Sperm count was highest in ejaculates collected at the temperatures then have no negative effects on ejaculation lowest atmospheric pressure range, not more than 990 hPa. performance of boars. Ejaculates collected at higher (Fig. 3) It exceeded 64 billion (109) and was higher by more temperatures had a significantly lower sperm concentration. than 4.1 billion than in ejaculates collected at 996-1000 Spermatogenesis runs best in air temperature ranging hPa (P<0.05). The greatest number of insemination doses from 15 to 20°C in bulls [17]. Most ejaculates in this study per ejaculate, exceeding 25, was found in low atmospheric were collected within this thermal range (groups II and III). pressures not exceeding 990 hPa (Group I) and at high Air temperature at ejaculation is not, however, the only pressures above 1010 hPa (Group VI). The average number factor that may affect the ejaculate traits. Air temperature of insemination doses obtained from ejaculates qualified during the entire period of spermatogenesis is also vital, for the Groups II, III, IV and V was lower by more than 1.5 and this period may begin as early as 70 days before insemination doses (P<0.05). ejaculation [18]. 230 Effect of Piggery Microclimate ... Motility and morphology of sperm are sensitive Ejaculates collected at 10°C and lower had the highest indicators of heat stress [19]. The extent of morphological sperm concentrations. These results in conformity with changes in spermatozoa depends on the duration of heat data published by Ciereszko et al.[9] and Trudeau and impact and on the adaptability of males to the conditions Sanford [29], who analyzed ejaculates in relation to the of heat stress [20]. Adaptation is less easy with higher diurnal season of semen collection. According to Knecht et al.[6], a temperature variations [21]. Heat stress directly affects high sperm concentration in ejaculates collected in winter reproductive performance of boars, but also has an indirect results from lower temperatures, which has a positive impact, by provoking changes in the energy balance [22]. effect on spermatogenesis. Auvigne [30] believes that this Wettemann et al.[23] observed that increased temperature effect is due to the close kinship between the modern of the air is accompanied by a reduced quality of porcine breeds of pigs and the European wild boar, for which the semen without distinct changes in the ejaculate volume period of breeding activity is in late autumn and early or libido. Increased thermal conditions resulted in sperm winter, a period of a shortening length of daylight. This concentration reduced by 50% and in decreased average was confirmed by Knecht et al.[31], who obtained ejaculates sperm motility, from 79.5% to 46.4% between the 3rd and of larger volume and with higher motility sperm from 6th week of observations [23]. Stone [24], on the other hand, boars of various breeds during the period July - December, observed that sperm motility - as a result of temperature which was reflected in more insemination doses obtained increase from 20°C to 40°C - dropped from about 93% to from one ejaculate. 19% after 3 weeks of such treatment. Our results reveal that sperm motility increases with an increase in temperature The results obtained in this study indicate that air at ejaculation. Semen was collected at temperatures rather relative humidity during the collection of ejaculates varied remaining within the thermal comfort zone for swine. In and depended largely on the season (Fig. 2). this study, the temperature never exceeded 29°C, at which - Air relative humidity in the piggery was 56-60% over according to Sonderman and Luebbe [25] - spermatogenesis most of the days of semen collection during autumn and undergoes serious disturbances. Our study revealed that winter (September - January). Ejaculates collected during the highest proportion of progressively motile sperm was this period were characterized by a large volume (250.17 in ejaculates collected within the range 16-20°C and above ml on average) and a very low sperm concentration 20°C (respectively 72.77% and 72.75%). (367.73x103/mm3). On the other hand, ejaculates collected Season may affect the air temperature during the at a relative humidity of 50% and lower had the smallest collection of ejaculates, which is particularly important volume (230.90 ml) and the highest sperm concentration 3 3 in a temperate climate zone [2]. Therefore, in this study (412.91 x10 /mm ). Such an air humidity level was most we recorded the number of days per each month when frequent from February to April (Fig. 2), when ejaculates ejaculates were collected at a specific temperature (Fig. 1). also had the highest sperm count (65.22 billion), enabling preparation of the highest number of doses (25.06 per The data presented in Table 1 show that the best semen ejaculate). With an increase in air humidity in the piggery, traits (ejaculate volume, motility, total sperm count) were a higher rate of sperm showing progressive motility was found in semen collected at temperatures above 16°C. observed too. Ejaculates collected at humidity lower or These ejaculates allowed preparation of the most AI equal 60% demonstrated a lower percentage of progressively doses. Monthly temperature distribution depicted in Fig. motile sperm as compared with the semen collected at an 1 shows that the most days of semen collection at such air humidity above 66%. temperatures are located between May and September. The period from May to September is not a good time in Relative air humidity is closely related to air temperature. swine reproduction cycle [26]. At this time, boars generally There is the view that a combined effect of high temperature produce ejaculates of lower quality. In summer the sexual and high humidity is more detrimental to the functioning activity of boars is often less intensive, which manifests of testes than the effects of these two factors acting [32] [33] in smaller ejaculate volumes and lower sperm counts, separately . McNitt and First found that placing boars as reflected in the number of insemination doses made. for 72 h in a climatic chamber at 33°C and a relative humidity Lower sperm counts in ejaculates collected in the summer of 50% resulted in a decrease in the total spermatozoa months, as compared with the rest of the year, were found count in the ejaculate and an increase in the percentage in the studies by Flowers [27]. During this period also more of spermatozoa with morphological abnormalities within morphologically abnormal sperm are found [28]. The data of about two weeks of the treatment. Similar conclusions [34] the presented study indicate, however, that this might were reached by Larsson and Einarsson , who placed not always be the case. boars for 100 h at 35°C and a relative humidity of 40%. The results were reduced ejaculate volume and a higher Air temperature in swine farming facilities strongly percentage of abnormal spermatozoa; total sperm depend on the year season, which is depicted in Fig. 1. counts in the ejaculates, however, remained unchanged. The most days of semen collection in which temperature Suriyasomboon et al.[35] demonstrate that temperature and did not exceed 10°C were from December to February. relative humidity have a significant effect on the volume of 231 KOWALEWSKI, KONDRACKI, GÓRSKI BAJENA, WYSOKIŃSKA ejaculate, and the total sperm count in ejaculates obtained semen collection has little influence on the total number from boars managed in various systems in Thailand. The of sperm per ejaculate and the number of artificial authors found that a temperature increase in facilities insemination doses obtainable from a single ejaculate. for boars above 29°C at a relative humidity higher than 70% may have a negative effect on spermatogenesis. The REFERENCES number of articles on the impact of humidity on ejaculation performance is low and their results do not lead to clear 1. Kondracki S, Iwanina M, Wysokińska A, Górski K: The use of sexual activity measurem ent to assess ejaculatory performance of boars. Arch conclusions. The data in this study prove that humidity Tierzucht, 56, 1052-1059, 2013. DOI: 10.7482/0003-9438-56-106 is important for the quality of boar ejaculates and that in 2. Wysokińska A, Kondracki S, Kowalewski A, Adamiak A, Muczyńska practice there are large fluctuations in air humidity during E: Effect of seasonal factor on the ejaculate properties of crossbred duroc the collection of ejaculates. Therefore, there is a need for x pietrain and pietrain x duroc boars as well as purebred duroc and research and analysis of the impact of relative humidity pietrain boars. Bull Vet Inst Pulawy, 53, 677-685, 2009. on the basic quantitative and qualitative characteristics 3. Oberlender G, Murgas LDS, Zangeronimo MG, Silva AC, Pereira of ejaculate. LJ: Influence of ejaculation time on sperm quality parameters in high performance boars. J Anim Sci Adv, 2, 499-509, 2012. The impact of atmospheric pressure during the collection 4. Robinson JAB, Buhr MM: Impact of genetic selection on management of boar rep lacement. Theriogenology, 63, 668-678, 2005. DOI: 10.1016/j. of ejaculates on their physical characteristics proved to theriogenology.2004.09.040 be minor [36]. The highest sperm concentrations were 5. Kondracki S, Banaszewska D, Mielnicka C: The effect of age on the obtained at an atmospheric pressure of 990 hPa and lower. morphometric sperm traits of domestic pig (Sus scrofa domestica). Cell Ejaculates collected at the lowest atmospheric pressure Mol Biol Lett, 10, 3-13, 2005. were found to have the lowest sperm motility. Differences 6. Knecht D, Środoń S, Duziński K: The influence of boar breed and between the other groups were insignificant and were not season on semen parameters. S Afr J Anim Sci, 44, 1-9, 2014. DOI: 10.4314/ confirmed statistically. Atmospheric pressure is also partly sajas.v44i1.1 related to the season of the year. Monthly distribution of 7. Wysokińska A, Kondracki S: Assessment of the effect of heterosis on semen para me ters of two-breed crosses of Duroc, Hampshire and Pietrain atmospheric pressure at the time of collecting ejaculates boars. Arch Tierzucht, 56, 65-74, 2013. DOI: 10.7482/0003-9438-56-007 is shown in Fig. 3. 8. Tsakmakidis IA, Khalifa TAA, Boscos CM: Age-related changes in quality and fertility of porcine semen. Biol Res, 45, 381-386, 2012. DOI: The data presented in Fig. 3 demonstrate that during 10.4067/S0716-97602012000400009 spring and summer (April - August), air pressure in the 9. Ciereszko A, Ottobre JS, Głogowski J: Effects of season and breed of piggery during semen collection was usually 1001-1005 sperm acrosin activity and semen quality of boars. Anim Reprod Sci, 64, hPa, and in autumn (November, December) 996-1000 hPa. 89-96, 2000. DOI: 10.1016/S0378-4320(00)00194-9 Winter was characteristics for its highly varied pressure 10. Corcuera BD, Herńandez-Gil R, Alba Romero CD, Martin Rillo distribution in each month of the season. The data S: Relationship of environment temperature and boar facilities with seminal quality. Livest Prod Sci, 74, 55-62, 2002. DOI: 10.1016/S0301- presented in this study, however, are hard to compare with 6226(01)00286-X other studies, since reports on these are lacking. 11. Sancho S, Pinart E, Briz M, Garcia-Gil N, Badia E, Bassols J, Kadar E, Pruneda A, Bussalleu E, Yeste M, Coll MG, Bonet S: Semen In conclusion, the studied microclimate parameters quality of postpubertal boars during increasing and decreasing natural in the place of ejaculate collection may affect the quality photoperiods. Theriogenology, 62, 1271-1282, 2004. DOI: 10.1016/j. of ejaculates. This effect, however, is varied. Each of the theriogenology.2004.01.003 tested microclimate factors (temperature, humidity and 12. Cheon YM, Kim HK, Yang CB, Yi YJ, Park CS: Effect of season atmospheric pressure) affects the characteristics of influencing semen characteristics, frozen-thawed sperm viability and testosterone concentration in Duroc boars. Asian-Aust J Anim Sci, 15, 500- collected ejaculates differently and to a varying degree. 503, 2002. DOI: 10.5713/ajas.2002.500 Air temperature and atmospheric pressure at the time of 13. Frangez R, Gider T, Kosec M: Frequency of boar ejaculate collection: semen collection affect the volume of the ejaculate and Its influence on semen quality, pregnancy rate and litter size. Acta Vet concentration of sperm in the semen. Ejaculates with the Brno, 74, 265-273, 2005. DOI: 10.2754/avb200574020265 highest sperm concentration are obtained at extremely 14. Mažeika K, Sutkevičiene N, Žilinskas H, Riškevičiene V, Aniuliene low temperatures (10°C or less), and at extremely low A, Juodžiukyniene N: Relationship between sperm quality and testicular lesions in culled AI boars. Vet Med Zoot, 59, 52-57, 2012. relative humidity. Sperm motility exhibits a distinct and 15. Ordinance of the Minister of Agriculture and Rural Development: oriented dependence in relation to air temperature, Journal of Laws, 2010, No. 56, 15 February 2010. www.isap.sejm.gov.pl, relative humidity of the air and atmospheric pressure. In item 344, Accessed: 08.04.2010. ejaculates collected at the lowest air temperature, relative 16. King GJ, Macpherson JW: A comparison of two methods for humidity of the air and atmospheric pressure were found boar semen collection. J Anim Sci, 36, 563-565, 1973. DOI: 10.2134/ least sperm with progressive motility. The highest numbers jas1973.363563x of sperm are found in ejaculates obtained at extremely low 17. Parkinson TJ: Seasonal variations in semen quality of bulls: relative humidity (50% and lower) and at extremely low Correlations with environmental temperature. Vet Rec, 120, 479-482, 1987. DOI: 10.1136/vr.120.20.479 atmospheric pressure (not exceeding 900 hPa). Ejaculates 18. Igna V, Moje A, Mircu C, Roman M, Ghiurca C, Casaleau D, Cernescu collected in these conditions yielded the highest number H: The influ ence of some environmental factors and age on semen of artificial insemination doses. Air temperature during production of Fleckvieh bulls. Luc St Med Vet, 63, 56-63, 2010. 232 Effect of Piggery Microclimate ... 19. Lipenský J, Lustyková A, Čeřovský J: Effect of season on boar sperm 28. Brito LFC, Silva AEDF, Rodrigues LH, Vieira FV, Deragon LAG, morphology. J Cent Eur Agric, 11, 465-468, 2010. Kastelic JP: Effects of environmental factors, age and genotype on 20. Einarsson S, Brandt Y, Lundeheim N, Madej A: Stress and its sperm production and semen quality in Bos indicus and Bos taurus Al influence on reproduc tion in pigs: a review. Acta Vet Scand, 50, 48-56, bulls in Brazil. Anim Reprod Sci, 70, 181-190, 2002. DOI: 10.1016/S0378- 2008. DOI: 10.1186/1751-0147-50-48 4320(02)00009-X 21. Kunavongkrit A, Suriyasomboon A, Lundeheim N, Heard TW, 29. Trudeau V, Sanford LM: Effect of season and social environment on Einarsson S: Manage ment and sperm production of boars under testis size and semen quality of the adult Landrace boar. J Anim Sci, 63, differing environmental conditions. Theriogenology, 63, 657-667, 2005. 1211-1219, 1986. DOI: 10.1016/j.theriogenology.2004.09.039 30. Auvigne V, Leneveu P, Jehannin C, Peltoniemi O, Salle E: Seasonal 22. Rensis DF, Scaramuzzi RJ: Heat stress and seasonal effects on infertility in sows: A five year field study to analyze the relative roles reproduction in the dairy cow - a review. Theriogenology, 60, 1139-1151, of heat stress and photoperiod. Theriogenology 74, 60-66, 2010. DOI: 2003. DOI: 10.1016/S0093-691X(03)00126-2 10.1016/j.theriogenology.2009.12.019 23. Wettemann RP, Wells ME, Omtvedt IT, Pope CE, Turman EJ: 31. Knecht D, Środoń S, Szulc K, Duziński K: The effect of photoperiod Influence of elevated ambient temperature on reproductive performance on selected parame ters of boar semen. Livest Sci, 157, 364-371, 2013. of boars. J Anim Sci, 42, 664-669, 1976. DOI: 10.1016/j.livsci.2013.06.027 24. Stone BA: Heat induced infertility of boars: The interrelationship 32. Malmgren L, Larsson K: Experimental induced testicular alterations between depressed sperm output and fertility and an estimation of the in boars: Histologic al and ultrastructure finding. Zbl Vet Med A, 36, 3-14, critical air temperature above which sperm is impaired. Anim Reprod 1989. DOI: 10.1111/j.1439-0442.1989.tb00696.x Sci, 4, 283-299, 1982. DOI:10.1016/0378-4320(82)90043-4 33. McNi tt JI, First NL: Effects of 72-hour heat stress on semen 25. Sonderman JP, Lueb be JJ: Semen production and fertility issues quality in boars. Int J Biometeorol, 14, 373-380, 1970. DOI: 10.1007/ related to differences in genetic lines of boars. Theriogenology, 70, 1380- BF01462914 1383, 2008. DOI: 10.1016/j.theriogenology.2008.08.009 34. Larsson K, Einarsson S: Seminal changes in boars after heat stress. 26. De Ambrogi M, Ballester J, Saravia F, Caballero I, Johannisson A, Acta Vet Scand, 25, 57-66, 1984. DOI: 10.1186/1751-0147-50-48 Wallgren M, Andersson M, Rodríguez-Martínez H: Effect of storage 35. Suriyasomboon A, Kunavongkrit A, Lundeheim N, Einarsson S: in short-and long-term commercial semen extenders on the motility, Effect of temperature and humidity on sperm production in Duroc boars plasma membrane, and chromatin integrity of boar spermatozoa. Int J under different housing systems in Thailand. Livest Prod Sci, 89, 19-31, Androl, 29, 543-552, 2006. DOI: 10.1111/j.1365-2605.2006.00694.X 2004. DOI: 10.1016/j.livprodsci.2003.12.008 27. Flowers WL: Genetic and phenotypic variation in reproductive 36. Olczak K, Nowicki J, Klocek C: Pig behaviour in relation to weather traits of AI boars, Theriogen ology, 70, 1297-1303, 2008. DOI: 10.1016/j. conditions - A review. Ann Anim Sci, 15, 601-610, 2015. DOI: 10.1515/aoas- theriogenology.2008.06.016 2015-0024 Kafkas Univ Vet Fak Derg KafKas Universitesi veteriner faKUltesi Dergisi 22 (2): 233-236, 2016 JoUrnal Home-Page: http://vetdergi.kafkas.edu.tr Research Article DOI: 10.9775/kvfd.2015.14238 online sUbmission: http://vetdergikafkas.org Presence of Salmonella spp., Listeria monocytogenes, Escherichia coli O157 and Nitrate-Nitrite Residue Levels in Turkish Traditional Fermented Meat Products (Sucuk and Pastırma) [1] [2] Serkan Kemal BÜYÜKÜNAL 1 Fitnat Şule ŞAKAR 1 İlkay TURHAN 1 Çınar ERGİNBAŞ 1 Sema SANDIKÇI ALTUNATMAZ 2 Filiz YILMAZ AKSU 2 Funda YILMAZ EKER 3 Tolga KAHRAMAN 3 [1] This study was presented as a poster presentation in International VETistanbul Group Congress 2015, St.Petersburg, Russia [2] This work was financially supported by the Research Fund of the University of Istanbul (Project number: 49382) 1 Istanbul Arel University, School of Health Sciences, Department of Nutrition and Dietetics, TR-34537 Buyukcekmece, Istanbul - TURKEY 2 Istanbul University, Vocational High School, Food Technology Programme, TR-34320 Istanbul - TURKEY 3 Istanbul University, Faculty of Veterinary Medicine, Department of Food Hygiene and Technology, TR-34320 Avcilar, Istanbul - TURKEY KVFD-2015-14238 Received: 17.08.2015 Accepted: 16.10.2015 Published Online: 05.11.2015 Abstract Turkish sucuk and pastırma are traditional meat products commonly consumed in Turkey. These products are generally known as dry fermented meat products (FMP), fermented and ripened naturally. Curing is a preparation method for FMPs used for prolonging shelf life. As well as additives such as nitrate and nitrite are used to obtain the desired colour and flavour, also inhibit the mentioned bacteria. Despite the advantages of the curing agents, FMPs may pose a risk for human health via uncontrolled (out of limits) usage. The present study was conducted to investigate the incidence of Salmonella spp., Listeria monocytogenes and Escherichia coli O157 and nitrate-nitrite contents in 132 sucuk and 66 pastırma samples collected from producers and retailers in Istanbul, Adapazari, Afyon and Kayseri. Salmonella spp. and L. monocytogenes were detected 2.52% and 2.02% in all samples, respectively. All samples were negative for E. coli O157. The nitrate level of sucuk and pastırma samples were found was in the acceptable range. Only, 5 of sucuk samples exceeded the nitrite limit value. The results indicate that meat products may be contaminated with pathogens and nitrosamines can be present in meat products. Furthermore, the essential precautions should be taken to apply sanitation procedure and improve the quality of production technology. Keywords: Sucuk, Pastırma, Listeria monocytogenes, Salmonella spp., Nitrate-nitrite Geleneksel Türk Fermente Et Ürünlerinde (Sucuk ve Pastırma) Salmonella spp., Listeria monocytogenes, Escherichia coli O157 ve Nitrat-Nitrit Varlığı Özet Türk tipi sucuk ve pastırma Türkiye’de yaygın olarak tüketilen geleneksel et ürünleridir. Doğal olarak fermente olup olgunlaşan bu ürünler genellikle fermente edilerek kurutulmuş et ürünleri olarak bilinirler. Kürleme fermente edilerek kurutulmuş et ürünlerinde kullanılan bir hazırlama metodu olup raf ömrünü uzatmak amacıyla kullanılır. Nitrat ve nitrit gibi katkı maddeleri de arzu edilen renk ve aromanın şekillenmesini sağlarken aynı zamanda bazı bakterilerin üremesinin inhibe edilmesi için de kullanılır. Kürleme ajanlarının avantajlarına rağmen, fermente edilerek kurutulmuş et ürünlerinde kontrolsüzce (limit değerlerin üzerinde) kullanımları sağlık risklerine sebep olabilir. Bu çalışma İstanbul, Adapazarı, Afyon ve Kayseri’deki perakende satış noktaları ve üreticilerden toplanan 132 sucuk ve 66 pastırma örneğinde Salmonella spp., Listeria monocytogenes ve Escherichia coli O157 varlığını ve nitrat-nitrit içeriğini tespit etmek için yürütüldü. Salmonella spp. ve L. monocytogenes sırasıyla %2.52 ve %2.02 olarak tespit edildi. Hiçbir örnekte E. coli O157 tespit edilemedi. Sucuk ve pastırma örneklerinin nitrat düzeyi kabul edilebilir düzeyde bulundu. Sadece sucuk örneklerinin beşinde nitrit limit düzeyinin aşıldığı tespit edildi. Sonuçlar et ürünlerinin patojenlerle kontamine olabileceğini ve et ürünlerinde nitrozaminlerin bulunabileceğini göstermiştir. Buna ek olarak, uygulanan sanitasyon prosedürlerinde zorunlu tedbirler alınmalı ve üretim teknolojisinde kalite iyileştirilmelidir. Anahtar sözcükler: Sucuk, Pastırma, Listeria monocytogenes, Salmonella spp., Nitrat-nitrit  İletişim (Correspondence)  +90 212 8600481  serkanbuyukunal@arel.edu.tr 234 Presence of Salmonella spp., ... INTRODUCTION For detection of L. monocytogenes, 25 g food samples were mixed with 225 ml of Listeria Enrichment Broth (Oxoid Turkish type dry fermented sausage (sucuk) and CM0862) containing Listeria Selective Supplement (Oxoid pastırma are traditional meat products widely consumed in SR 141). Samples were homogenized in a stomacher bag Turkey. These products are known as dry fermented meat for 60 sec and incubated at 32ºC for 24 h. 0.1 ml portion products (FMP) manufactured by natural fermentation of the enrichment broth was streaked onto Chromogenic and generally consumed without cooking [1-3]. Despite the Listeria Agar (Oxoid CM1080) supplemented with Listeria fermentation periods the foodborne pathogens that can Selective Supplement (Oxoid SR0227) and Listeria be present in the gastrointestinal tract of food-producing Differential Supplement (Oxoid SR0228). After incubation, animals are potential sources of risk for human health [4]. typical colonies were transferred to Tryptic Soy-Yeast These organisms are subsequently transferred to meat Extract Agar (Oxoid CM0131) and incubated for 24 to 48 products and people due to poor hygiene, sanitation h at 30ºC. These colonies were verified by Gram’s staining, conditions and handling procedures during slaughtering catalyses reaction, tumbling motility at 25ºC, Methyl Red- and production [5]. Vogues Proskauer (MR-VP) reactions, CAMP test, nitrate reduction and fermentation of sugars [11]. Curing is a traditional culinary technique is used for prolonging the shelf life of meat products [6]. The curing For detection of E. coli O157, each sample was examined agents nitrite and nitrate not only help producers obtain by combining 25 g with 225 ml of modified Tryptone Soya the desired flavour and colour; but also have inhibitor Broth (Oxoid CM0989) into a stomacher bag, homogenized effect on several pathogen microorganisms in fermented for at least 2 min and incubated at 37ºC for 24 h. Enriched meat products [7]. Despite their technological and safety cultures were streaked onto Sorbitol MacConkey Agar advantages, high intake of nitrate-nitrite constitutes a (Oxoid CM0813) supplemented with Cefixime Tellurite risk to human health, in rare occasions causing allergenic Selective Supplement (Oxoid SR172) and incubated at effects and carcinogenic nitrosamines [8,9]. 37ºC for 18 to 24 h. Following the incubation period, the colourless colonies were tested by E. coli O157 latex kit The present study was undertaken to determine the (Oxoid DR0620) [12]. prevalence of Salmonella spp., Listeria monocytogenes and Escherichia coli O157 and the contents of nitrate-nitrite Determination of Nitrate and Nitrite Content: Nitrate in sucuk and pastırma obtained from retail markets and and nitrite concentrations in the samples were determined producers in Istanbul, Adapazari, Afyon and Kayseri, the by the HPLC method based on the Nordic Committee on major sucuk and pastırma producing cities in Turkey. Food Analysis Method No. 165. The solution was injected onto the Shimadzu LC10 chromatograph. Nitrate and nitrite MATERIAL and METHODS were separated by an Alltech C18 column and measured with an ultraviolet light detector at a wavelength of 205 nm. The limit of quantification for both ions was 5mg/kg-1; Sample Collection: Sucuk and pastırma samples were the measurement uncertainty (U) at a concentration of 100 collected at intervals between March 2012 and February mg/kg was 12 mg/kg (k=2, normal) [13]. 2013. A total of 132 sucuk and 66 pastırma samples were examined for the presence of Salmonella spp., L. monocytogenes, E. coli O157 and nitrate-nitrite contents. RESULTS Samples were obtained from producers and retailers in Salmonella spp. and L. monocytogenes were detected at Istanbul, Adapazari, Afyon and Kayseri. All samples were 1.52% and 1.52% in sucuk and 4.55% and 3.03% in pastırma collected in their original packages and transferred to the º samples, respectively (Table 1). All samples were negative laboratory at 4 C. for E. coli O157. According to Turkish Food Codex [14], the Microbiological Analysis: For isolation of Salmonella presence of Salmonella spp. and E. coli O157 in 25 g of raw spp., pre-enrichment was done by suspending 25 g beef or ground beef as well as the presence of Salmonella of sample in 225 ml buffered peptone water (BPW - spp. and L. monocytogenes in 25 g of sucuk is unacceptable. Oxoid CM0509), followed by incubation at 37ºC for 16 The results of nitrate and nitrite concentrations are to 20 h. A 0.1 ml sample of the mixture was transferred shown in Table 2. to Rappaport-Vassiliadis (RV - Oxoid CM0866) and Muller Kaufmann Tetrathionate Broth (MKTTn - Oxoid CM0343) DISCUSSION and they were incubated for 24 h at 42ºC. Samples were streaked on Hectoen Enteric Agar (Oxoid CM0419) and XLD The presence of Salmonella spp. in fermented meat Agar (Oxoid CM0469) after incubation and incubated an products have been examined in several studies. Oksuztepe additional 24 h at 35ºC. The typical colonies were identified et al.[15] demonstrated that Salmonella spp. was isolated by biochemical tests and confirmed with Salmonella from 3.0% of products. Erdogrul and Ergun [16] reported antiserum (O and H-Vi polyvalent antiserum) [10]. that 1.66% was found to be the positive for Salmonella 235 BÜYÜKÜNAL, ŞAKAR, TURHAN, SANDIKÇI ALTUNATMAZ YILMAZ AKSU, YILMAZ EKER, KAHRAMAN Table 1. Prevalence of Salmonella spp., L. monocytogenes and E. coli O157 at very low levels together with very high levels of in sucuk and pastırma samples competitor organisms which is making it difficult to detect. Tablo 1. Sucuk ve pastırma örneklerinde Salmonella spp., L. monocytogenes ve E. coli O157 prevalansı Regarding the contamination rate of sausages, the Salmonella spp. L. monocytogenes E. coli O157 results in this study were low. The reason for the low Products contamination rate is likely due to the fermentation process + % + % + % which reduces the number of pathogens during curing Sucuk (n=132) 2 1.52% 2 1.52% - - or storing time. Lactobacilli play an important role in the Pastırma (n=66) 3 4.55% 2 3.03% - - protection against the pathogens and in the development Total (n=198) 5 2.53% 4 2.02% - - of flavour by producing lactic acid [30]. The presence of lactic acid accelerates pH decline and water activity, improving +: number of positive samples the safety and stability of these products [31]. Table 2. The results of nitrate and nitrite concentrations in sucuk and pastırma samples Tablo 2. Sucuk ve pastırma örneklerinde nitrat ve nitrit konsantrasyon sonuçları Sucuk (n=132) Pastırma (n=66) Parameters Satisfactory Unacceptable Samples Min Max Mean Min Max Mean Limit by TFC (Sucuk/Pastırma) Nitrate (mg/kg) 28.10 174.62 87.28 64.12 187.66 108.83 250 (0/0) Nitrite (mg/kg) 6.41 90.02 24.83 4.26 46.28 17.33 50 (5/0) (3.79%) TFC: Turkish Food Codex spp. The findings were highly consistent with these results In the present study, the nitrate concentrations of (1.52% in sucuk and 4.55% in pastırma). In other studies, samples were found a mean of 87.28 mg/kg in sucuk no Salmonella spp. was isolated [17,18]. Contrarily, two and 108.83 mg/kg in pastırma. The mean value of nitrite studies which reported higher results (5.0% and 7.0%) concentrations was 24.83 and 17.33 with a range of 6.41 than this study were those of Kok et al.[19] and Siriken et to 90.02 mg/kg and 4.26 to 46.48 mg/kg in sucuk and al.[20]. They explained the high Salmonella spp. prevalence pastırma samples, respectively. Today, many countries with varying hygiene applications at slaughterhouses enforce production limits of nitrate and nitrite. In general, and meat markets. Different detection rates may originate 250 mg/kg of nitrate and 50 mg/kg of nitrite are to be from detection methods, sampling procedures and the permitted for all meat products [32]. sanitation applications. In the present study, the highest rates of Salmonella spp. The prevalence of L. monocytogenes in the fermented (4/5) and L. monocytogenes (3/4) were detected in June, July samples tested in this study was lower than those detected and August which have the highest temperatures in Turkey. by Farber et al.[21] in Canada (20.0%), Cantoni et al.[22] in Italy Temperature is considered the most critical factor for the (13.0%), Jemmi et al.[23] in Switzerland (15.0%) and Colak microbial quality of meat at the stage of manufacture, et al.[24] in Turkey (11.6%). On the other hand, Mena et al.[25] distribution and consumption. Microbial growth is seen reported the prevalence rate of L. monocytogenes was corresponds directly with temperature increase [33]. 3.7% in 27 Spanish fermented sausages while Ciftcioglu and Ugur [26] detected only 2.0% in their Turkish samples. Nitrate is necessary in a long curing process to act as a The findings of this study showed similarity with the source of nitrite [34]. In the present study, the nitrate level of mentioned results. Differences between the findings from sucuk and pastırma samples were found all to be in the these studies can be related to production techniques, acceptable range. The findings corroborated studies of contaminations after production process, preservation Sanlı and Kaya [35] and Servi [36]. On the contrary, higher conditions and inadequate personal hygiene. In this values were found by Sezer et al.[37] and Soyutemiz and study Listeria species were also detected in 9 samples as Ozenir [38]. Five (3.79%) of the sucuk samples exceeded L. innocua (in 5 samples), L. seeligeri (in 2 samples) and 2 L. the nitrite limit value, but the nitrite level in pastırma was welshimeri (in 2 samples). within the satisfactory limit. Similar results were reported by Aksu ve Kaya [39], El-Khateib et al.[40] and Sancak et al.[41]. According to the results from this study, E. coli O157 was not detected. Similar results were reported by Ferreira et In conclusion, the result of this study confirmed that al.[27] in Portugal and Siriken et al.[20] in Turkey. In Argentina, meat products can become contaminated pathogens 4.8% of 83 fresh sausages and 3.3% of 30 dry sausages such as Salmonella spp. and L. monocytogenes, which can were contaminated with E. coli O157 [28]. Tilden et al.[29] cause serious public health problems. The quality of raw reported that E. coli O157:H7 was linked to consumption of meat, heat treatment of the meat, the activity of the starter fermented salami in USA. E. coli O157 presents sporadically culture, the salting process and the storage conditions are 236 Presence of Salmonella spp., ... the most important points of control for the prevention 21. Farber JM, Sanders GW, Johnston MA: A survey of various foods of growth/survival of undesirable microorganisms during for the presence of Listeria species. J Food Prot, 52, 456-458, 1989. the manufacturing process [42]. Therefore, it is essential 22. Cantoni C, Aubert SD, Valenti M, Comi G, Aubert S: Listeria spp. in cheese and dry sausages. Ind Alliment, 28 (276): 1068-1070, 1989. and beneficial to apply good hygienic practice, good 23. Jemmi T, Pak S, Salman MD: Prevalence and risk factors for manufacturing practice, HACCP and to develop standard contamination with L. monocytogenes of imported and exported meat production procedures for controlling foodborne pathogens and fish products in Switzerland, 1992-2000. Prev Vet Med, 54, 25-36, and enhancing the safety of food. Further studies to 2002. DOI: 10.1016/S0167-5877(02)00017-X identify the risk factors for the presence of pathogens in the 24. Colak H, Hampikyan H, Ulusoy B, Bingol EB: Presence of Listeria production of sucuk and pastırma should be carried out. monocytogenes in Turkish style fermented sausage (sucuk). Food Control, 18, 30-32, 2007. DOI: 10.1016/j.foodcont.2005.08.003 REFERENCES 25. Mena C, Almeida G, Carneiro L, Teixeira P, Hogg T, Gibbs PA: Incidence of Listeria monocytogenes in different food products commercialized 1. Anar S: Et ve Et Ürünleri Teknolojisi. 239-257, Dora Yayınevi, Bursa, 2010. in Portugal. Food Microbiol, 21, 213-216, 2004. DOI: 10.1016/S0740- 2. Arslan A: 0020(03)00057-1 Et Muayenesi ve Et Ürünleri Teknolojisi. 666-673, Özkan Yayınevi, Ankara, 2013. 26. Ciftcioglu GR, Ugur M: Kıyma, sucuk, tavuk etlerinde L. monocytogenes 3. Tekinşen OC, Doğruer Y: Her Yönüyle Pastırma. Selçuk Üniversitesi kontaminasyonu. J Fac Vet Med Istanbul Univ, 18 (2): 33-34, 1992. Basımevi, Konya, 2006. 27. Ferreira V, Barbosa J, Silva J, Felício MT, Mena C, Hogg T: 4. Little CL, Monsey HA, Nichols GL, Louvois J: The microbiological Characterisation of alheiras, traditional sausages produced in the North quality of ready to eat dried and fermented meat and meat products. Int of Portugal, with respect to their microbiological safety. Food Control, J Environ Health Res, 8, 277-284, 1998. DOI: 10.1080/09603129873381 18, 436-440, 2007. DOI: 10.1016/j.foodcont.2005.11.011 5. Norrung B, Buncic S: Microbial safety of meat in the European Union. Meat 28. Chinen I, Tanaro JD, Miliwebsky E, Lound LH, Chillemi G, Ledri S: Sci, 78, 14-24, 2008. DOI: 10.1016/j.meatsci.2007.07.032 Isolation and characterization of Escherichia coli O157:H7 from retail meats in Argentina. J Food Prot, 64, 1346-1351, 2001. 6. Honikel KO: The use and control of nitrate and nitrite for the processing of meat products. Meat Sci, 78, 68-76, 2008. DOI: 10.1016/j. 29. Tilden JJr, Young W, McNamara AM, Custer C, Boosel B, Lambert- meatsci.2007.05.030 Fair MA: A new route of transmission for Escherichia coli: Infection from dry 7. Öz F, Kaya M, Aksu Mİ: fermented salami. Am J Public Health Nations Health, 86, 1142-1145, 1996. Sucuk üretiminde farklı nitrit dozlarının ve starter kültür kullanımının Escherichia coli O157:H7’nin gelişimi üzerine etkisi. Turk 30. Fontan MCG, Lorenzo JM, Martinez S, Franco I, Carballo J: J Vet Anim Sci, 26, 651-657, 2002. Microbiological characteristics of Botillo a Spanish traditional pork 8. Kurt S, Zorba O: The microbiological quality of Turkish dry fermented sausage. LWT-Food Sci Technol, 40, 1610-1622, 2007. DOI: 10.1016/j. sausage (sucuk), as affected by ripening period, nitrite level and heat lwt.2006.10.007 treatment. Food Sci Technol Res, 16,191-196, 2010. DOI: 10.3136/fstr.16.191 31. Drosinos EH, Mataragas M, Xiraphi N, Moschonas G, Gaitis F, 9. Marco A, Navarro JL, Flores M: The influence of nitrite and nitrate Metaxopoulos J: Characterization of the microbial flora from a traditional on microbial, chemical and sensory parameters of slow dry fermented Greek fermented sausage. Meat Sci, 69, 307-317, 2005. DOI: 10.1016/j. sausage. Meat Sci, 73, 660-673, 2006. DOI: 10.1016/j.meatsci.2006.03.011 meatsci.2004.07.012 10. Harrigan WF: Laboratory Methods in Food Microbiology. Academic 32. Turkish Food Codex (TFC-Regulation): Republic of Turkey Official Press Ltd., California, 1998. Newspaper. 16 Nov 1997, Number 23172, Ankara, 1997. 11. Hitchins AD: Bacteriological Analytical Manual. 8th ed., Food and 33. Aydin A, Colak H, Ciftcioglu GR, Ugur M: Changes in microbiological Drug Adminstration, AOAC International, Gaithersburg-USA, 1995. properties of boneless beef in a one year study. Arch Lebensmittelhyg, 12. Hitchins AD, Feng P, Watkins WD, Rippey SR, Chandler LA: 57, 50-54, 2006. Escherichia coli and the coliform bacteria. In, Food and Drug Administration. 34. Toldra F: European standards on additives: Implications of nitrates 8th ed., 401-429, AOAC International, Washington DC, 2000. and nitrites reduction in dry cured ham. In, III Congreso Mundial del Jamon, 13. Merino L, Edberg U, Fuchs G, Aman P: Liquid chromatographic Teruel (Espana), 18-20 May, 2005. determination of residual nitrite-nitrate in foods: NMKL collaborative study. 35. Sanlı Y, Kaya S: Ankara piyasasında satılan bazı işlenmiş et ürünlerinin J AOAC Int, 83 (2): 365-375, 2000. nitrat ve nitrit içerikleri üzerine araştırmalar. Ankara Univ Vet Fak Derg, 14. Turkish Food Codex (TFC): Microbiological Criteria Notification. 35 (1): 24-46, 1988. Premiership Press, 2011/28157, Ankara, 2011. 36. Servi K: Elazığ bölgesinde tüketime sunulan et ve süt ürünlerinde 15. Öksüztepe G, Güran HŞ, İncili GK, Gül SB: Elazığ’da tüketime sunulan nitrat ve nitrit düzeylerinin belirlenmesi. FU Saglik Bilim Derg, 7, 101-116, 1993. fermente sucukların mikrobiyolojik ve kimyasal kalitesi. FÜ Sağ Bil Vet Derg, 37. Sezer C, Aksoy A, Celebi O, Deprem T, Ogun M, Bilge Oral N, 25 (3): 107-117, 2011. Vatansever L, Güven A: Evaluation of the quality characteristics of 16. Erdogrul O, Ergun O: Kahramanmaraş piyasasında tüketilen fermented sausages and sausage-like products sold in Kars. Eurasian J sucukların bazı fiziksel, kimyasal, duyusal ve mikrobiyolojik özellikleri. J Fac Vet Sci, 29 (3): 143-149, 2013. Vet Med Istanbul Univ, 31 (1): 55-65, 2005. 38. Soyutemiz GE, Özenir A: Determination of residual nit rate and nitrite 17. Günşen U, Büyükyörük İ, Arlı V: Bursa ili askeri birliklerinde tüketilen contents of dry fermented sausage, salami, sausage and pastırma consumed sucuk, salam ve sosislerin mikrobiyolojik kaliteleri. Pendik Vet Mikrobiyol in Bursa. Food, 21, 471-476, 1996. Derg, 32, 37-41, 2001. 39. Aksu MI, Kaya M: Erzurum piyasasında tüketime sunulan pastırmaların 18. Sancak YC, Kayaardı S, Sagun E, İşleyici Ö, Sancak H: Van piyasasında bazı fiziksel, kimyasal ve mikrobiyolojik özellikleri. Turk J Vet Anim Sci, 25, 319- tüketime sunulan fermente Türk sucuklarının fiziksel, kimyasal, mikrobiyolojik ve 326, 2001. organoleplik niteliklerinin incelenmesi .YYU Vet Fak Derg, 7, 67-73, 1996. 40. El-Khateib T, Schmidt U, Leistner L: Mikrobiologische stabilität von 19. Kok F, Ozbey G, Muz A: Determination of microbiologic quality of türkischer pastirma. Fleischwirtschaft, 67 (1): 101-105, 1987. fermented sausages produced in Aydın province. FÜ Sağ Bil Vet Derg, 21, 249- 41. Sancak YC, Ekici K, İşleyici Ö: Nitrate and nitrite residue levels in 252, 2007. fermented Turkish sausages and pastrami. YYU Vet Fak Derg, 19, 41-45, 2008. 20. Siriken B, Pamuk S, Ozakın C, Gedikoglu S, Eyigör M: A note on 42. Yalçın H, Can ÖP: Geleneksel yöntemle üretilen sucuklarda Listeria incidences of Listeria spp. and E. coli O157:H7 serotypes in Turkish sausage monocytogenes, Staphylococcus aureus ve koliform varlığının araştırılması. (Soudjouck). Meat Sci, 72: 177-181, 2006. DOI: 10.1016/j.meatsci.2005.05.025 Kafkas Univ Vet Fak Derg, 19, 705-708, 2013. DOI: 10.9775/kvfd.2013.8610 Kafkas Univ Vet Fak Derg KafKas Universitesi veteriner faKUltesi Dergisi 22 (2): 237-243, 2016 JoUrnal Home-Page: http://vetdergi.kafkas.edu.tr Research Article DOI: 10.9775/kvfd.2015.14277 online sUbmission: http://vetdergikafkas.org Isolation and Characterization of Olfactory Stem Cells from Canine Olfactory Mucosa [1] Korhan ALTUNBAŞ 1 Mustafa Volkan YAPRAKÇI 2 Sefa ÇELİK 3 [1] This work is a preliminary study of the project which was supported by the Scientific and Technical Research Council of Turkey. (TUBITAK) under Grant No. TOVAG-115O443 1 Afyon Kocatepe University, Faculty of Veterinary Medicine, Department of Histology and Embryology, TR-03200 Afyonkarahisar - TURKEY 2 Afyon Kocatepe University, Faculty of Veterinary Medicine, Department of Surgery, TR-03200 Afyonkarahisar - TURKEY 3 Afyon Kocatepe University, Faculty of Medicine, Department of Biochemistry, TR-03200 Afyonkarahisar - TURKEY Article Code: KVFD-2015-14277 Received: 23.08.2015 Accepted: 29.09.2015 Published Online: 02.10.2015 Abstract Olfactory stem cells have great potential in the treatment of neurodegenerative diseases and they are good candidates for cell therapy due to the easy accessibility of olfactory mucosa. The main objectives of this study were isolation, proliferation and characterization of olfactory mucosa stem cells that were further differentiated into olfactory neurospheres derived cells. When grown on poly-D- lysine with a serum-free culture medium supplemented with EGF (50 ng/ml) and FGF2 (50 ng/ml), olfactory stem cells gave rise to neurospheres. When grown in serum-containing culture medium newly plated spheres gave rise to olfactory neurosphere derived cells. Gene expression analysis revealed that, OCT4, SOX2, Nanog, Nestin, β-tubulin and NCAM were expressed in olfactory stem cells. While the mRNA expressions of Nanog, Nestin, Oct4, βIII-tubulin and NCAM were downregulated in neurospheres, the mRNA expression of SOX2 upregulated in neurospheres. According to the gene levels of neurospheres generated from olfactory stem cells, beta tubulin and NCAM gene expressions were upregulated, whereas OCT4, Nanog, Sox2 and Nestin mRNA expressions were downregulated in Olfactory neurospheres derived cells. Olfactory mucosa of canine is a suitable alternative source of stem cells and can be applied to cell therapy in neurodegenerative diseases. Keywords: Olfactory stem cell, Canine, Neurosphere, Pluripotent Köpek Olfaktorik Mukozasindan Olfaktorik Kök Hücrelerin Izolasyonu ve Karakterizasyonu Özet Olfaktorik kök hücreler nörodejeneratif hastalıkların tedavisinde büyük bir potansiyele sahiptir ve olfaktorik mukozaya kolay erişilebilirliği sayesinde hücre tedavisi için uygun bir adaydır. Bu çalışmanın amacı olfaktorik nörosfer kaynaklı hücrelere kadar farklılaştırılabilen olfaktorik kök hücrelerin izolasyonu, proliferasyonu ve karakterizasyonudur. Olfaktorik kök hücreler EGF (50 ng/ml) ve FGF (50 ng/ml) içeren serumsuz kültür vasatı içerisinde kültüre edildiğinde nörosferleri oluşturdular. Serum içeren kültür vasatında tekrar kültüre edildiklerinde olfaktorik nörosfer kaynaklı hücreleri şekillendirdiler. Gen ekspresyon analizleri OCT4, SOX2, Nanog, Nestin, β-tubulin ve NCAM genlerinin olfaktorik kök hücrelerinde eksprese olduğunu ortaya çıkardı. Nanog, Nestin, Oct4, β tubulin ve NCAM gen ekspresyonları nörosferlerde downregüle olurken, SOX2 geni upregüle oldu. Olfaktorik kök hücrelerin oluşturduğu nörosferlerin gen seviyeleri ile karşılaştırıldığında olfaktorik nörosfer kaynaklı hücrelerde β tubulin ve NCAM gen ekspresyonları upregüle olurken OCT4, Nanog, Sox2 and Nestin mRNA ekspresyonları downregüle oldu. Köpeğin olfaktorik mukozası uygun alternatif bir kök hücre kaynağıdır ve köpek nörodejeneratif hastalıklarında hücre tedavisi için uygulanabilir. Anahtar sözcükler: Olfaktorik kök hücre, Köpek, Nörosfer, Pluripotent INTRODUCTION which supplies new granule cells to the dentate gyrus of the hippocampus; the subventricular zone, which supplies Neurogenesis takes place in three primary areas in the new interneurons to the olfactory bulb; and the olfactory nervous system. These areas include: the subgranular zone, neuroepithelia, which generates new excitatory sensory  İletişim (Correspondence)  +90 505 6294313  korhana@aku.edu.tr 238 Isolation and Characterization ... neurons that extend their axons to the olfactory bulb [1]. to a previous report [10]. Briefly the mucosal biopsies were NSCs (Neural stem cells) that are derived directly from CNS dissected under a stereomicroscope to remove cartilage (Central nervous system) tissue are considered to be safe fragments, blood vessels, connective tissues and non- and non-tumorigenic [2]. Furthermore, NSCs are excellent olfactory mucosa. The remaining OM was rinsed three candidates for cellular transplantation therapy because times with Hank balance salt solution (HBSS) with 1% PS they have been shown to replace the dead or dying neural (Peniciline and Streptomycine; Invitrogen; 15140122), and tissues, elaborate trophic factors to rescue dysfunctional transferred (with minimal dissection) into a 35 mm petri endogenous neurons, inhibit inflammation, and deliver dish containing HBSS with 1% PS. OM was cut into pieces therapeutic proteins in a widely disseminated manner [3-7]. of about 1 mm3 with a scalpel blade for 1 min (Fig. 1a,b), However, harvesting such cells directly from the CNS and by applying explants culture, the tissue was kept in is an invasive procedure with ethical considerations [8]. culture flasks of 25 cm2 at 37°C in High Glucose DMEM/ OM (Olfactory mucosa) of human and dog can easily be F-12 medium (Biochrom, Cat. #FG-0445) supplemented obtained from cribriform plate of ethmoidal bone with with 10% fetal bovine serum (FBS, Biochrom Cat. #S0113), a non-invasive nasal biopsy [9-12]. Thus, stem cells derived and 1% PS. After 7 days of incubation of the explants from canine OM stand as a promising candidate for a in culture medium, medium was begun to change every two source of autologous graft, due to their accessibility [10,12,13]. days. These cells were confluents after 8 day of culture. At It is well known that new neurons are continuously this time, the culture medium was aspirated and cells generated from the stem cells in OM throughout life [14,15]. were washed with HBSS. Then, the cells were incubated Neurogenesis within the OM is substantiated by niches of with 1 ml of trypsin-EDTA solution (Gibco Cat #25200- stem cells, located both in the OE (olfactory epithelium) 056) for 5 min at 37°C. The separated cells were collected, and in the underlying olfactory lamina propria. Within centrifuged and re-plated at the rate of 1:2 for subculture. the OE, two distinct populations of stem cells contribute The medium was changed each two days up to the to the neurogenic process, namely the HBCs (horizontal confluence of the cells in the flask. basal cells) and the GBCs (globose basal cells) [16]. A new Olfactory Neurosphere Formation and Growing stem cell population from mesenchymal stem cell family has been recently discovered in lamina propria of OM [17-19]. To form NSs, trypsinized cells were re-plated into culture Lamina propria derived stem cells named as ecto- T25 flask pretreated with poly-D-lysine and fed with DMEM/ mesenchymal stem cells have attracted the interest of HAM F12 (Serum-free culture medium, Invitrogen #31331- the researchers, having advantages of easily accessible 028) supplemented with ITS-X 1%, (insulin, transferrin, location, a high proliferation rate, an ability to proliferate selenium invitrogen #51500056); EGF (epidermal growth in long-term cultures and a tendency to differentiate into factor, 50ng/ml, R&D Systems Cat. #236-EG ); FGF2(basic neural cells [20]. Therefore, OM has been considered to fibroblast growth factor, 50 ng/ml, Cat. #233-FB ) and 1% be an essential source for adult neural stem cells. Neural PS as previously described [9]. In order to collect olfactory stem cells in OM are multipotent and can be grown into neurospheres lysates, the culture medium with the floating NSs (neurospheres), as well as further differentiate into NSs was transferred to 15 ml tubes. Then, 2 ml of DMEM/ neurons, astrocytes, and oligodendrocytes in vitro [21]. Thus HAM F12 was added to the flask, and with a micropipette, the generation of NSs is often considered as a sufficient fluxes and refluxes were performed to release the NSs that evidence for the existence of a stem cell. were still adherents. These NSs in suspension were added The importance of the dog, being as a large animal to the same 15 ml tubes. model of human neurodegenerative diseases, has led to The tubes were centrifuged at 1.100 rpm for 3 min interest in the isolation and characterization of dog stem (Nuve NF 800R) and the supernatants were removed. cells derived from various tissues such as adipose, bone marrow and amnion [22-24]. These were dissociated with trypsin, replated into T25 flasks and cultured in serum containing culture medium. In this study, our aim was to isolate and characterize These ONS (olfactory neurospheres derived) cells were a stem cell population from canine OM as an alternative then expanded by passage and these cells were stored in source of adult stem cells rather than bone marrow and -80ºC for Real Time PCR analysis. adipose tissue for the treatment of neurodegenerative diseases in canine. Total RNA Isolation and mRNA Expression Levels of Genes by Real-time Reverse Transcription-Polymerase MATERIAL and METHODS Chain Reaction (RT-PCR) Cell Culture Total RNA was isolated by RNAeasy  kit (QIAGEN) and cDNA was generated with a First Strand cDNA Synthesis OM was obtained from each dog according to previous kit (Thermo Scientific) at a total volume of 20 μl according description [25]. Primary cell culture was performed according to the manufacturer’s instructions. Real-time quantitative 239 ALTUNBAŞ, YAPRAKÇI ÇELİK PCR was performed in a Strategene Mx3005P QPCR system cell clusters formations were also observed after passage. (USA). Expression levels of target genes were normalized Primary cultures were mainly composed of elongated to the housekeeping gene β-actin (ΔCt). Gene expression adherent cells (Fig. 1d). values were then calculated based on the  ΔΔCt method using the equation: RQ = 2−ΔΔCt. PCR amplification was To assay the potential of OS (olfactory stem) cells performed with Maxima SYBR Green/ROX qPCR Master for generatation of NSs, OS cells were plated onto Mix  (Thermo  Scientific). The primer sequences used in poly-D-lysine coated T25 flask culture petri dishes PCR reactions and PCR conditions are described in Table filled with DMEM/ HAM F12 supplemented with ITS-X 1. Each assay was performed in triplicate and repeated (1%), EGF and FGF2. OS cell generated NSs by the next day. three times. As shown in (Fig. 1e,f), the NSs had a spherical structure. In order to assay their ability to differentiate into ONS RESULTS cells, olfactory NSs were collected and re-plated in serum containing culture medium. The medium was totally Each slice of OM was plated in T25 flask and fed with a renewed once every 2 days. ONScells rapidly proliferated serum- containing High Glucose DMEM/F-12 medium. as an adherent monolayer (Fig. 1g,h). After 5 to 7 days, OM derived cells started to grow out of mRNA Expression Levels of Genes in Olfactory the explant and proliferate (Fig. 1c). The culture medium Stem Cells, Neurosphere, Olfactory Neurospheres- was totally renewed every 2 days. When the culture had Derived Cells reached confluency after 8 days, the cells were passaged and grown in T75 flasks to obtain large quantities of cells. Real time PCR analysis showed that OS cells expressed In the new flasks culture, proliferation, expansion and pluripotent stem cell genes such as OCT4, Nanog, Sox2 Table 1.Oligonucleotide primer sequences and PCR programs Tablo 1. Oligonükleotid primer sekanslarıve PCR programları Transcripts Primer Sequences PCR Programs Cycles Nestin F: 5′-5′-GAGAACCAGGAGCAAGTGAA-3′R: 3′-TTTCCAGAGGCTTCAGTGTC-5′ In.95˚C 5’/95˚C 10’-58˚C 30’’-72˚C 1’ 35 βIII-tubulin F: 5′-GAGGGCGAGATGTACGAAGA-3′R: 3′-CCTATGGTGGGAAAACAGGA-5′ In.95˚C 5’/95˚C 10’-58˚C 30’’-72˚C 1’ 35 GFAP F: 5′-CGAGTTACCAGGAGGCACTA-3′R: 3′-TCCACGGTCTTTACCACAAT-5′ In.95˚C 5’/95˚C 10’-56˚C 30’’-72˚C 1’ 35 NCAM F: 5′-AGGCAGAGCATAGTGAATGC-3′R: 3′-AGGCTTCACAGGTCAGAGTG-5′ In.95˚C 5’/95˚C 10’-58˚C 30’’-72˚C 1’ 35 NANOG F: 5′-GAATAACCCGAATTGGAGCAG-3′R: 3′-AGCGATTCCTCTTCACAGTTG-5′ In.95˚C 5’/95˚C 10’-58˚C 30’’-72˚C 1’ 45 OCT4 F: 5′-GCAGTGACTATTCGCAACGA-3′R: 3′-ATTTGAATGCATGGGAGAGC-5′ In.95˚C 5’/95˚C 10’-58˚C 30’’-72˚C 1’ 35 SOX2 F: 5′-AGTACAACTCCATGACCAGC-3′R: 3′-ATCATGTCCCGGAGGTC-5′ In.95˚C 5’/95˚C 10’-58˚C 30’’-72˚C 1’ 35 GAPDH F: 5′-TGACACCCACTCTTCCACCTTC-3′R: 3′-CGGTTGCTGTAGCCAAATTCA-5′ In.94˚C 2’/94˚C 20’’-55˚C 15’’-72˚C 1’ 35 Table 2. Comparison of mRNA expression levels of genes Tablo 2. Genlerin mRNA ekspresyon düzeylerinin karşılaştırılması mRNA Expression Levels of Genes (fold increase +/decrease -) Groups Oct4 Nanog Sox2 Nestin β Tubulin NCAM GFAP 1 1.0 1.0 1.0 1.0 1.0 1.0 - 2a (-) 1.8 (- ) 1.8 (+) 1.3 (-) 1.6 (-) 2.8 (-) 5.2 - 3 1.0 1.0 1.0 1.0 1.0 1.0 - 4b (-) 2.1 (- ) 1.1 (-) 3.4 (-) 1.1 (+) 1.4 (+) 3.3 - a: Compare to the group 1. Group 1: OS cell, Group 2: neurospheres generated from OS cells; b: Compare to the group 3. Group 3: neurospheres generated from OS cells, Group 4: olfactory neurospheres-derived cells 240 Isolation and Characterization ... Fig 1. A. OM collection and B. OM tissue pieces of about 1 mm3; C. cells adhesions close to the fragments; D. spindle shaped adherent cells; E and F. neurosphere formation; G and H. ONS cells Şekil1. A. OM toplanması ve B. Yak-laşık 1 mm3 büyüklükte OM doku parçaları; C. doku parçacıkların yakınında hücre tutunmaları; D. mekik şeklinde tutunan hücreler; E ve F. nörosfer şekillenmesi; G ve H. ONS hücreleri genes, neural stem cell gene Nestin and neural specific The expression of the neural stem cell marker Nestin genes NCAM, beta tubulin III, but the expression of was downregulated in the NSs derived from OS cells. Also, astrocyte-specific gene that was GFAP was not present beta tubulin and NCAM expressions were determined (Table 2). to be downregulated in the NSs. GFAP was detected in 241 ALTUNBAŞ, YAPRAKÇI ÇELİK neither NS nor ONS cells as in OS cells. In particular, the containing culture medium, they were plated on poly- expression of pluripotent stem cell markers OCT4 and D-lysine coated T25 flask that was filled with serum free Nanog was downregulated in NSs when compared with culture medium supplemented with ITS, EGF and FGF2 the mRNA levels in OS cells. But the expression of another at a 1:2 split ratio. The following day, OS cells had given pluripotent stem cell marker Sox2 was found high in rise to NSs under neurospheres forming conditions. the NSs (Table 2). According to the gene levels of NSs Optimal cell plating density for NS formation is important. generated from OS cells, beta tubulin and NCAM gene Optimal plating cell density should be 16.000 cell/cm2 expressions were upregulated, whereas OCT4, Nanog, according to Girard et al.[9] but it should be 50.000 cell/ Sox2 and Nestin mRNA expressions were downregulated cm2 according to Carvalho et al.[20]. We got the best results in ONS cells (Table 2). for NS formation when we cultured the stem cells at a 1:2 split ratio. In this way, we successfully made OS cells DISCUSSION turned into neurospheres in one day. In the present study, the expressions of the neural stem cell marker Nestin OM generates 2 distinct types of NSs as follows: as well as the neural precursor markers βIII-tubulin and mesenchymal-like olfactory stem cells from lamina propria NCAM were detected in canine OS cells. In previous studies [23,24,34]and epithelial-like OS cells from OE [9,20]. OE stem cells are , these markers were also found in similiar to olfactory propria stem cells with their identical mesenchymal stem cells which were consistent with our primary cultures morphological appearance, expression of findings. On the otherhand, we could not determine the stemness marker nestin or ability to form NSs which the GFAP mRNA expression in stem cells consisted with [24] can subsequently proliferate as ONS cells or terminally results of the study of Chung et al. . Furthermore, ecto- differentiate into neuron-like cells [20]. Thus, we did not mesenchymal stem cells (also named “mesenchymal- need to separate OE from lamina propria to isolate stem neural” precursors) have the capacity to differentiate into cells from each other. We collected canine OM according ectoderm and mesoderm cell types. Accordingly, ecto- to a previous report [25] and to obtain OS cells, we chosed mesenhcymal stem cells can also be expressing these the non-enzymatic method in which the tissue slices neural markers in olfactory mucosa. At the same time, co- left undisturbed for five days caused adherence of the expression of neural markers such as Nestin, βIII-tubulin explants to the plastic surface and subsequent emergence and NCAM except for GFAP shows high potential of canine of the cell population [26]. Some researchers reaffirmed our OS cells to differentiate into multiple neural lineage in approach [17,27] that nonenzymatic methods conserved the vitro. Nestin is expressed not only in nervous system quality of the both OS cells and olfactory ensheating cells. organs such as olfactory mucosa but also in other organs Explantation causes minimal trauma to the tissue which is and tissues. This may be the evidence that nestin- critical for cell quality. Within 5-7 days of explant culture, the containing cells are pluripotent and may not be exclusively spindle-shaped cells were observed migrating out of tissue of neuroepithelial origin, such that nestin cannot be explant onto the culture dish. Similar observations were unambiguously interpreted as a marker of neural stem/ observed by Alves et al.[10]. The migrated cells possessed progenitor cells [35]. Additionally, olfactory stem cells differ typical mesenchymal morphology and continued to from bone marrow stem cells by over-expressing CD9 and [17] proliferate till 7 days. The cells were maintained in culture under-expressing CD146 and CD200 . CD9 belongs to for a total of 15 days to attain confluence. When the the tetraspanin family and is considered as a pluripotency [36] culture reached confluence, the cells were passaged and marker . Afterwards Chaker N. Adra discovered and [37] transfered into the new culture flask. We observed OS cells patented that pluripotent stem cell populations could in the form of elongated- spindle shaped morphology in be obtained from olfactory mucosa and reported that the culture flask. some cells of the pluripotent stem cell population could differentiate into cells of one or more various lineages such Various culture conditions generate NSs [19,28-32] that as mesenchymal lineages or neuronal lineages or both. differ varying by species (human, rat, mouse), developmental Thus, in this study, we also investigated the expression of stage (embryo, neonatal, adult), presence of serum, pluripotent genes such as OCT4, Nanog and Sox2 because chemicals, and trophic factors. Here we used a serum-free canine embryonic stem cells were demonstrated to express culture method (supplemented with ITS, EGF and FGF2) Oct4, Nanog, and Sox2 at high levels [38]. Sox2 governs ESC to generate NSs from adult canine OS cells, because stem specification to neuroectoderm while Oct4 and Nanog cells differentiated in the presence of growth factors and promote their differentiation to mesendoderm, a common serum-free medium are safer for clinical use [24]. At the precursor of mesoderm and definitive endoderm [39], and same time EGF has been demonstrated to be a mitogen Sox2 is a critical factor for directing the differentiation for neural stem cells as has FGF2, and both factors in of pluripotent stem cells to neural progenitors and for combination have been used to expand neural stem cells [16]. maintaining the properties of neural progenitor stem Also FGF2 causes growth in neural tube formation [33]. Thus, cells [40]. In this study, we observed expressions of these EGF and FGF2 together resulted in the most neurospheres pluripotent genes in OS cells and detected the down- forming [16]. Once the OS cell reach confluent in serum regulation of Nanog, Oct4 and the upregulation of Sox2 242 Isolation and Characterization ... in the NSs derived from OS cells. Furthermore, Nestin epithelium. Pesquisa Veterinaria Brasileira, 30, 363-372, 2010. DOI: 10.1590/ expression was downregulated in neurospheres and ONS S0100-736X2010000400014 cells consisted with the results of Carvalho et al.[41]. NSs 11. AD Veron MM, C Bienboire-Frosini, D Royer, P Asproni, A Cozzi, contain a mixed population consisting of neural stem S D Girard, M Khrestchatisky, FS Roman, P Pageat: Are nasal stem cells a promising approach in geriatric veterinary medicine? In, IRSEA cells, proliferating neural progenitors and postmitotic Institute of Research in Semiochemistry and Applied Ethology, International neurons and glia [41]. Thus, in this study, the downrgulation Congress: Marseille, France, 2014. of Oct4, Nanong and Nestin and the upregulation of 12. Antoine Veron CB-F, Manuel Mengoli, Dany Royer, Alessandro Sox2 in NSs derived from OS cells indicated that there Cozzi, Stéphane D. Girard, Kevin Sadelli, Michel Khrestchatisky, was a decrease in pluripotent characteristics of NSs and François S. Roman , Patrick Pageat: Transplantation of olfactory stem cells in an aged dog displaying cognitive dysfunction: Preliminary clinical NSs highly expressing Sox2 gene have a high potential observation. In, FENS Forum, Milan, 2014. for differentiating towards functional neurons. Olfactory 13. Pageat P, Veron A, Royer D, Frosini C, Asproni P, Mengoli M, Cozzi A: NSs were collected, dissociated and rapidly grown in the Engraftment of senile dogs with olfactory stem cells: Preliminary results presence of serum as an adherent monolayer of ONS cells. for a promising treatment. In, AVSAB Annual Congress: Denver, Colorado, These ONS cells had a flattened and undifferentiated July, 2014. appearance with a marker phenotype similar to the 14. Duggan CD, Ngai J: Scent of a stem cell. Nat Neurosci, 10, 673-674, 2007. DOI: 10.1038/Nn0607-673 ectomesenchymal cells derived from primary cultures of 15. Mackay-Sim A: Stem cells and their niche in the adult olfactory OM [17,35]. That is, they expressed markers of mesenchymal mucosa. Arch Ital Biol, 148 (2): 47-58, 2010. stem cells (CD105 and CD73) as well as other stem and 16. Wetzig A, Mackay-Sim A, Murrell W: Characterization of olfactory progenitor cell proteins (Oct4, Nestin, and beta tubulin) [35]. stem cells. Cell Transplant, 20, 1673-1691, 2011. DOI: 10.3727/09636 In this study, we demonstrated that ONS cell expressed 8911x576009 a lower level of pluriptency genes and a higher level of 17. Delorme B, Nivet E, Gaillard J, Haupl T, Ringe J, Deveze A, neuronal genes compared with that of NS. Our findings Magnan J, Sohier J, Khrestchatisky M, Roman FS, Charbord P, Sensebe L, Layrolle P, Feron F: The human nose harbors a niche of highlight that pluripotent stem cells could be isolated from olfactory ectomesenchymal stem cells displaying neurogenic and OM and they could be differentiated into NS and ONS cells, osteogenic properties. Stem Cells Dev, 19, 853-866, 2010. DOI: 10.1089/ and therefore, these cells are suitable candidates for cell Scd.2009.0267 transplantation in neurodegenerative diseases of canine. 18. Murrell W, Wetzig A, Donnellan M, Feron F, Burne T, Meedeniya A, Kesby J, Bianco J, Perry C, Silburn P, Mackay-Sim A: Olfactory mucosa is REFERENCES a potential source for autologous stem cell therapy for Parkinson’s disease. Stem Cells, 26, 2183-2192, 2008. DOI: 10.1634/Stemcells.2008-0074 1. Brann JH, Firestein SJ: A lifetime of neurogenesis in the olfactory 19. Tome M, Lindsay SL, Riddell JS, Barnett SC: Identification of system. Front Neurosci, 8, 182, 2014. DOI: 10.3389/Fnins.2014.00182 nonepithelial multipotent cells in the embryonic olfactory mucosa. Stem 2. Schwarz SC, Schwarz J: Translation of stem cell therapy for neurological Cells, 27, 2196-2208, 2009. DOI: 10.1002/Stem.130 diseases. Transl Res, 156, 155-160, 2010. DOI: 10.1016/J.Trsl.2010.07.002 20. Carvalho SDBdO: Establishing stem cell based systems to study 3. Einstein O, Karussis D, Grigoriadis N, Mizrachi-Kol R, Reinhartz E, neuropathologies. PhD Thesis, Universidade de Aveiro Secção Autónoma de Abramsky O, Ben-Hur T: Intraventricular transplantation of neural pre- Ciências da Saúde, 2012. cursor cell spheres attenuates acute experimental allergic encephalomyelitis. 21. Reynolds BA, Weiss S: Generation of neurons and astrocytes from Mol Cell Neurosci, 24, 1074-1082, 2003. DOI: 10.1016/J.MCN.2003.08.009 isolated cells of the adult mammalian central nervous system. Science, 4. Lacorazza HD, Flax JD, Snyder EY, Jendoubi M: Expression of human 255, 1707-1710, 1992. DOI: 10.1126/science.1553558 beta-hexosaminidase alpha-subunit gene (the gene defect of Tay-Sachs 22. Lim JH, Boozer L, Mariani CL, Piedrahita JA, Olby NJ: Generation disease) in mouse brains upon engraftment of transduced progenitor and characterization of neurospheres from canine adipose tissue- cells. Nat Med, 2, 424-429, 1996. DOI: 10.1038/Nm0496-424 derived stromal cells. Cell Reprogram, 12, 417-425, 2010. DOI: 10.1089/ 5. Ourednik J, Ourednik V, Lynch WP, Schachner M, Snyder EY: Neural Cell.2009.0093 stem cells display an inherent mechanism for rescuing dysfunctional 23. Kim EY, Lee KB, Yu J, Lee JH, Kim KJ, Han KW, Park KS, Lee DS, Kim neurons. Nat Biotechnol, 20, 1103-1110, 2002. DOI: 10.1038/Nbt750 MK: Neuronal cell differentiation of mesenchymal stem cells originating 6. Pluchino S, Quattrini A, Brambilla E, Gritti A, Salani G, Dina G, from canine amniotic fluid. Hum Cell, 27, 51-58, 2014. DOI: 10.1007/ Galli R, Del Carro U, Amadio S, Bergami A, Furlan R, Comi G, Vescovi S13577-013-0080-9 AL, Martino G: Injection of adult neurospheres induces recovery 24. Chung CS, Fujita N, Kawahara N, Yui S, Nam E, Nishimura R: A in a chronic model of multiple sclerosis. Nature, 422, 688-694, 2003. comparison of neurosphere differentiation potential of canine bone DOI: 10.1038/Nature01552 marrow-derived mesenchymal stem cells and adipose-derived mesenchymal 7. Snyder EY, Taylor RM, Wolfe JH: Neural progenitor cell engraftment stem cells. J Vet Med Sci, 75 (7): 879-886, 2013. corrects lysosomal storage throughout the MPS VII mouse brain. Nature, 25. Overall KL, Arnold SE: Olfactory neuron biopsies in dogs: A 374, 367-370, 1995. DOI: 10.1038/374367a0 feasibility pilot study. Applied Animal Behaviour Science, 105, 351-357, 2007. 8. Chung DJ, Wong A, Hayashi K, Yellowley CE: Effect of hypoxia DOI: 10.1016/j.applanim.2006.11.011 on generation of neurospheres from adipose tissue-derived canine 26. Singh N, Ranjan V, Zaidi D, Shyam H, Singh A, Lodha D, Sharma R, mesenchymal stromal cells. Vet J, 199, 123-130, 2014. DOI: 10.1016/J. Verma U, Dixit J, Balapure AK: Insulin catalyzes the curcumin-induced Tvjl.2013.10.020 wound healing: An in vitro model for gingival repair. Indian J Pharmacol, 9. Girard SD, Deveze A, Nivet E, Gepner B, Roman FS, Feron F: Isolating 44, 458-462, 2012. DOI: 10.4103/0253-7613.99304 nasal olfactory stem cells from rodents or humans. J Vis Exp, 54, e2762, 27. Neetu S, Saroj Chooramani G, Rajeshwar Nath S, Tulika C, Satya 2011. DOI: 10.3791/2762 Prakash A, Sanjay Kumar S, Devendra Kumar G, Anil Kumar B: In vitro 10. Alves FR, Guerra RR, Fioretto ET, Delgado JC, Machado AAN, maintenance of olfactory mucosa with enriched olfactory ensheathing cells. Ambrosio CE, Kerkis I, Miglino MA: Establishment of a protocol J Stem Cell Res Ther, 3, 1-8, 2013. DOI: 10.4172/2157-7633.1000132 for obtention of neuronal stem cells lineages from the dog olfactory 28. Zhang X, Klueber KM, Guo Z, Lu C, Roisen FJ: Adult human 243 ALTUNBAŞ, YAPRAKÇI ÇELİK olfactory neural progenitors cultured in defined medium. Exp Neurol, 186, 35. Matigian N, Abrahamsen G, Sutharsan R, Cook AL, Vitale 112-123, 2004. DOI: 10.1016/J.Expneurol.2003.10.022 AM, Nouwens A, Bellette B, An JY, Anderson M, Beckhouse AG, 29. Murrell W, Feron F, Wetzig A, Cameron N, Splatt K, Bellette B, Bennebroek M, Cecil R, Chalk AM, Cochrane J, Fan YJ, Feron F, Bianco J, Perry C, Lee G, Mackay-Sim A: Multipotent stem cells from McCurdy R, McGrath JJ, Murrell W, Perry C, Raju J, Ravishankar S, adult olfactory mucosa. Dev Dyn, 233, 496-515, 2005. DOI: 10.1002/ Silburn PA, Sutherland GT, Mahler S, Mellick GD, Wood SA, Sue CM, Dvdy.20360 Wells CA, Mackay-Sim A: Disease-specific, neurosphere-derived cells as models for brain disorders. Dis Model Mech, 3, 785-798, 2010. DOI: 30. Barraud P, He X, Zhao C, Ibanez C, Raha-Chowdhury R, Caldwell 10.1242/dmm.005447 MA, Franklin RJ: Contrasting effects of basic fibroblast growth factor and epidermal growth factor on mouse neonatal olfactory mucosa cells. Eur J 36. Hannan NR, Wolvetang EJ: Adipocyte differentiation in human Neurosci, 26, 3345-3357, 2007. DOI: 10.1111/J.1460-9568.2007.05950.X embryonic stem cells transduced with Oct4 shRNA lentivirus. Stem Cells Dev, 18, 653-660, 2009. DOI: 10.1089/Scd.2008.0160 31. Murdoch B, Roskams AJ: A novel embryonic nestin-expressing radial glia-like progenitor gives rise to zonally restricted olfactory and 37. Adra CN: Olfactory stem cells and uses thereof. Google Patents, 2010. vomeronasal neurons. J Neurosci, 28, 4271-4282, 2008. DOI: 10.1523/ 38. Hayes B, Fagerlie SR, Ramakrishnan A, Baran S, Harkey M, Jneurosci.5566-07.2008 Graf L, Bar M, Bendoraite A, Tewari M, Torok-Storb B: Derivation, 32. Krolewski RC, Jang W, Schwob JE: The generation of olfactory characterization, and in vitro differentiation of canine embryonic stem epithelial neurospheres in vitro predicts engraftment capacity following cells. Stem Cells, 26, 465-473, 2008. DOI: 10.1634/Stemcells.2007-0640 transplantation in vivo. Exp Neurol, 229, 308-823, 2011. DOI: 10.1016/J. 39. Thomson M, Liu SJ, Zou LN, Smith Z, Meissner A, Ramanathan S: Expneurol.2011.02.014 Pluripotency factors in embryonic stem cells regulate differentiation into 33. Ülger H, Özdamar S, Unur E, Pratten M: The effect of basic germ layers. Cell, 145, 875-889, 2011. DOI: 10.1016/J.Cell.2011.05.017 fibroblast growth factor (bFGF) on in vitro embryonic growth, heart and 40. Zhang S, Cui W: Sox2, a key factor in the regulation of pluripotency neural tube development in rat. Kafkas Univ Vet Fak Derg, 15, 673-679, 2009. and neural differentiation. World J Stem Cells, 6, 305-311, 2014. DOI: DOI: 10.9775/kvfd.2009.079-A 10.4252/Wjsc.V6.I3.305 34. Tondreau T, Lagneaux L, Dejeneffe M, Massy M, Mortier C, Delforge 41. Suslov ON, Kukekov VG, Ignatova TN, Steindler DA: Neural stem A, Bron D: Bone marrow-derived mesenchymal stem cells already cell heterogeneity demonstrated by molecular phenotyping of clonal express specific neural proteins before any differentiation. Differentiation, neurospheres. Proc Natl Acad Sci USA, 99, 14506-14511, 2002. DOI: 72, 319-326, 2004. DOI: 10.1111/J.1432-0436.2004.07207003.X 10.1073/pnas.212525299 Kafkas Univ Vet Fak Derg KafKas Universitesi veteriner faKUltesi Dergisi 22 (2): 245-251, 2016 JoUrnal Home-Page: http://vetdergi.kafkas.edu.tr Research Article DOI: 10.9775/kvfd.2015.14340 online sUbmission: http://vetdergikafkas.org RelA/p65-mediated Innate Immune Response Affecting NDV Replication in CEF Zhao-xiong WANG 1 Min-hua SUN 2 Yin-feng KANG 2 Peng XIE 2 Tao REN 2 1 College of Animal Science, Yangtze University, 88 Jing Mi Road, Jingzhou, Hubei, P. R. CHINA 2 Key Laboratory of Animal Diseases Control and Prevention of the Ministry of Agriculture; College of Veterinary Medicine, South China Agricultural University, 483 Wu Shan Road, Tian He District, Guangzhou 510642, P. R. CHINA Article Code: KVFD-2015-14340 Received: 06.09.2015 Accepted: 24.12.2015 Published Online: 19.01.2016 Abstract Newcastle disease virus (NDV) is a non-segmented and single-stranded negative-sense RNA (-)ssRNA virus. Previous studies indicate that NDV elicit hosts to induce strongly innate immune responses. The virus replication can cause hosts to express more type I interferon (IFN) via nuclear kappa B (NF-kB) pathways and further activate IFN-stimulated genes (ISGs) to retard virus growth and induce cells for developing specific protection. This study investigated the role of RelA/p65 in innate immune responses against NDV replication by using the virus infection chicken embryo fibroblast cells (CEF). The result showed that the mRNA and protein levels of RelA/p65 increased markedly in CEF infected with strains of NDV which differed in their virulence, and RelA/p65 translocated from the cytoplasm to the nucleus. Further research indicated that specific siRNA could inhibit expression of RelA/p65, accordingly, mRNA levels of IFN-α, IFN-β and STAT1 decreased significantly and the replication kinetics of 2 NDVs were enhanced after inhibition of RelA/p65. In conclusion, CEF can synthesize more type I IFN via RelA/p65 pathways after NDV infection, which retards NDV replication and spreads in the early phase of viral infection. Keywords: NDV, RelA/p65, Interferon, Virus replication, CEF CEF’teki NDV Replikasyonunu Etkileyen RelA/p65-güdümlü Doğal İmmun Tepki Özet Newcastle hastalığı virüsü (NDV) tek-parçalı ve tek-sarmallı negatif-yönlü RNA (-) SsRNA virüsüdür. Önceki çalışmalar, NDV’nin konakçıların güçlü doğal bağışıklık tepkilerini indüklediğini göstermektedir. Virüs replikasyonu nükleer kappa B (NF-kB) yolakları üzerinden daha fazla tip I (IFN) interferon ekspresyonuna, ve ayrıca IFN-uyarımlı genlerin (ISGs) aktive ederek daha fazla virüs büyümesini geciktirmek ve spesifik korumanın geliştirilmesi için hücrelerin uyarılmasına neden olabilir. Bu çalışmada, tavuk embriyo fibroblast hücreleri (CEF) virüs enfeksiyonu kullanılarak NDV replikasyonuna karşı doğal bağışıklık yanıtlarında RelA/p65’in rolü araştırıldı. Sonuç, RelA/p65’in mRNA ve protein düzeylerinin virülansları farklı NDV suşlarıyla enfekte CEF’de belirgin oranda arttığını ve RelA/p65’in sitoplazmadan çekirdeğe transloke olduğunu gösterdi. Ayrıca, araştırma spesifik siRNA’nın RelA/p65 ekspresyonunu inhibe edebildiğini, buna uygun olarak, IFN-α, IFN-β ve STAT1 mRNA düzeylerinin önemli ölçüde azaldığını ve 2 NDV’nin replikasyon kinetiğinin RelA/p65 inhibisyonu sonrası geliştirildiğini gösterdi. Sonuç olarak; CEF, NDV enfeksiyonu sonrasında RelA/p65 yolakları aracılığıyla daha fazla IFN türü sentezleyebilir ki, bu NDV replikasyonunu geciktirir ve viral enfeksiyonun erken döneminde yayılma gösterir. Anahtar sözcükler: NDV, RelA/p65, İnterferon, Virüs replikasyonu, CEF INTRODUCTION on the basis of their virulence: non-virulent (lentogenic), mildly virulent (mesogenic) and highly virulent (velogenic). Newcastle disease (ND) is recognized as a significant The NDV genome is approximately 15200 nucleotides poultry disease; it is caused by Newcastle disease virus long, and it composed of six units that encode their (NDV), a member of the Paramyxoviridae family [1]. NDV is a corresponding structural proteins: nucleocapsid protein non-segmented and single-stranded negative-sense RNA (NP), phosphoprotein (P), matrix protein (M), fusion virus. NDV isolates are usually classified into three groups protein (F), hemagglutinin-neuraminidase (HN), and a  İletişim (Correspondence)  +86 20 85283054; Fax: +86 20 5280242  rentao6868@126.com 246 RelA/p65-mediated Innate ... RNA-dependent RNA polymerase (L) [1,2]. RNA editing of doses (TCID50) per ml. UV-inactivation of viruses were the P protein produces additional non-structural proteins performed by using a UV Stratalinker 2400 (Stratagene, V and W [3]. NDV V protein can block various components USA) to prevent the expression of NDV hemagglutinin- of interferon (IFN) pathways to help the virus replication neuraminadase (HN) viral gene, and evaluated by immuno- and spread in host [3-6]. fluorescence analysis. The host’s innate immune response to virus infection Real-time Quantitative Polymerase Chain Reaction is an immediate reaction designed to retard virus growth (qPCR) and help the host develop specific protection [7-9]. One key protein that regulates the response is the nuclear CEF were infected with NDV strain LaSota or GM at a transcription factor, NF-kB, which is held quiescent in multiplicity of infection (MOI) of 0.1 TCID50/cell when they the cytoplasm when incomplex with IkBa [10,11]. Once in were grown to 70-80% confluence in 12-well plates. The response to virus via transmembrane toll-like receptors cells were harvested at 3, 6, 12 and 24 h post infection (TLRs) or the cytoplasmic sensors (e.g., RIG-I, MDA5, PKR (h p.i). Total RNA was extracted by using RNeasy® Mini and NOD proteins), IkBa is phosphorylated by IKK and kit (Promega, U.S.) and was used as a template for subject to ubiquitin-dependent proteasomal degradation, synthesizing cDNA strands. QPCR was prepared by using allowing NF-kB to translocate to the nucleus from the the following primers: 5’-AAGCCGACAAAACCACCC-3’ cytoplasm and activate the transcription of a cascade of (IFN-α-sense), 5’-CAGGAACCAGGCACGAGC-3’ (IFN-α-anti- proinflammatory cytokines and chemokines to induce sense), 5’-CCTCAACCAGATC -CAGCATT-3’ (IFN-β-sense) and inflammatory and antiviral responses [12-15]. Of particular 5’-GGATGAGGCTGTGAGAGGAG-3’(IFN-β-antisense), 5’-TG interest is RelA/p65, a subunit of the heterodimeric NF- AACGGATCCGCACCAATA-3’ (RelA/p65-sense), 5’-CGTTCAC kB protein, which had gained attention for its diverse CCACACCTGGAAG -3 ’ (RelA/p65-antisense), 5’-GAACGGCTA roles. It plays a central role in initiating the host’s antiviral CATTAGGACTG-3’ (STAT1-sense), 5’-GATCCGAGA-TACCT responses by inducing IFNs and ISGs [16,17]. CATCAAAC-3’ (STAT1-antisense), 5’-CCTCTCTGGCAAAGTCC AAG -3’ (GAPDH-sense), 5’-CATCTGCCCATTTGATGTTG -3’ Past research showed that NDV not only could induce (GAPDH-antisense). IFNα and IFNβ mRNA in macrophages, IFNγ mRNA in peripheral blood mononuclear cells in vitro [18-20], but Real time PCR (SYBR green) was performed by the also IFNα and IFNγ mRNA in splenocytes and peripheral ABI 7500 real-time PCR detection system (Roche Applied blood in vivo [21]. Yet this existing knowledge of NDV does Bio Systems, Germany). The Tm and Cp values were calculated not provide a full understanding role of RelA/p65 in the using the analysis software provided by Roche Applied IFN pathway, and whether the pathway affects NDV Science. The experimental data on the mRNA levels of replication. Here, using an in vitro model of NDV infection RelA/p65, IFN-α, IFN-β and STAT1 genes were normalized in CEF, we examined the global expression of RelA/p65, against internal controls, glyceraldehyde-3-phosphate- IFN-α/β and STAT-1, analysed the sub-cellular localisation dehydrogenase (GAPDH) gene. Fold changes in the of RelA/p65 protein in NDV-infected CEF, and determined expression of each gene were compared with expression NDV replication kinetics after inhibition of RelA/p65. The level in non-infected CEF, and analyzed by a comparative (ΔΔCt) experimental results indicated that two strains of NDV, threshold cycle (Ct) method using the formula 2- . which differed in their virulence could upregulate the Preparation of Cell Extract and Western Blot Analysis RelA/p65-mediated pathway, increased the expression of IFN-α and IFN-β, and limited the NDVs replication. Cells were washed three times with phosphate buffered saline (PBS), and then were lysed by a RIPA MATERIAL and METHODS buffer containing protease inhibitor PMSF. Lysates were incubated on ice for 10 min and then spun at 12.000xg Cell Culture and Viruses for 10 min; clarified supernatants were stored at -80°C. The supernatants were diluted 1:1 in a 2×Tris-glycine CEF and Vero cells were cultured under an atmosphere of SDS sample buffer (Invitrogen, U.S.). Proteins were 5% CO2 at 37°C in D-Minimum Essential Medium (D-MEM, resolved by sodium dodecyl sulfate polyacrylamide gel GIBCO®) supplemented with 10% fetal bovine serum (FBS) electrophoresis (SDS-PAGE) in 10% Tris-glycine gels and (PAA Laboratories, Ontario, Canada). The velogenic NDV then transferred onto nitrocellulose (NC) membranes. strain GM (of VII genotype) was stored in our laboratory The membranes were blocked with 5% skimmed milk and the lentogenic NDV strain LaSota was a kind gift from and then incubated with anti-RelA p65 antibody which the National Reference Laboratory for Newcastle Disease. could detect RelA/p65 for chicken (Abcam, U.K.). Following The GenBank accession numbers of the GM and LaSota primary incubation, a western blot analysis was performed strains are DQ486859 and AF077761, respectively. The with a FITC-conjugated goat anti-rabbit antibody (Millipore, virus titers were determined on CEF by standard endpoint Billerica, U.S.) according to the manufacturer’s protocol. dilution and expressed as 50% tissue culture infection Protein bands were imaged and quantified with the 247 WANG, SUN, KANG XIE, REN Odyssey infrared imaging system (Li-Cor, Odyssey). RESULTS The GAPDH expression levels, measured in parallel, served as a control. NDV up-regulate mRNA Levels of IFN-α, IFN-β, Immunofluorescence Staining STAT1 and RelA/p65 CEF were infected by NDV (LaSota or GM) with MOI To decipher how NDV enhanced the transcriptional of 0.1 TCID /cell or were treated by NDV (LaSota or GM)- activity of IFN-α, IFN-β and STAT1, we first examined 50 UV with same titer for 24 h. The cells were fixed with 4% whether NDV altered their mRNA levels along with that paraformaldehyde for 15 min and incubated with anti-RelA/ of RelA/p65 in NDV-infected CEF. Our results indicate that p65 antibody (Abcam, U.K.) in PBS containing 0.1% BSA at two strains of NDV could differentially modulate mRNA 4°C overnight. Following incubation with FITC-conjugated levels of the four molecules which are central to the innate goat anti-rabbit antibody (Millipore, Billerica, U.S.) for 1 h, antiviral response. As shown in Fig. 1, after 3 h of NDV the cells were stained with the nuclei, 4’, 6-diamidino-2- LaSota infection CEF, the mRNA levels of IFN-α, IFN-β, STAT1 phenylindole (DAPI; Sigma) for 10 min. After the cells were and RelA/p65 were strongly increased by 92, 8, 19 and 23 washed three times, they were photographed with a laser fold, respectively, in comparison with normal control cells. copolymerization microscope (Olympus, Japan). As time went by, the mRNA levels of the four molecules followed an obvious downward trend. The highly virulent RelA/p65 siRNA Treatment strain GM also induced CEF up-regulated mRNA levels of the four molecules compared to the control group, after CEF were seeded to 30% confluence into 12-well dishes 3 h of GM infection CEF, the mRNA levels of IFN-α, IFN-β, the day before transfection with small interfering RNA STAT1 and RelA/p65 were increased by 2.8, 1.4, 1.5 and (siRNA). The spectific siRNA (GenePharma, China) for 12 fold, respectively, in comparison with normal control chicken RelA/p65 (the sense strand is 5’- CGUGCACAGU cells. Compared to strain LaSota, the strain GM induced a UUCCAGAAUTT-3’ and the antisense strand is 5’-AUUCUGG lower mRNA level of the four molecules in infected CEF. AAACUGUGCACGTT-3’) and non-targeting siRNA (the Taken together, we know that two strains of NDV, which sense strand is 5’- UUCUCCGAACGUGUCACGUTT-3’ and the differ in their virulence, upregulated mRNA levels of IFN-α, antisense strand is 5’-ACGUGACACGUUCGG AGAATT-3’) IFN-β, STAT1 and RelA/p65 in CEF, but there were obvious was transfected into cells at a concentration of 40 pM using differences between the two NDVs induction mRNA levels the Lipofectamine RNAi Max reagent (Invitrogen, U.S.), of the four molecules. Knockdown efficiency was monitored using qPCR analysis for RelA/p65. The mRNA levels of IFN-α, IFN-β and STAT1 NDV up-regulate Protein Level of RelA/p65 were also measured at 24 h following RelA/p65-siRNA transfection into CEF. Fold changes in the expression Western blot analysis was carried out to demonstrate of each gene were compared with expression level in the protein level of RelA/p65 in NDV-infected CEF. The normal cells. results showed that NDV could induce CEF to synthesize more RelA/p65 protein. We also found differences in NDV Growth Kinetics the relative amount of RelA/p65 protein induced by two stains of NDV. In NDV strain LaSota infection CEF, the RelA/p65-siRNA (40 pM) was transfected into CEF when RelA/p65 protein was increased markedly at 3 h p.i., and the cells were grown to 70-80% confluence in 6-well plates. the amount reached to peak at 12 h p.i. Compared to the Twenty-four hours later, the cells were infected with NDV control group, the RelA/p65 protein was expressed at a strain LaSota with MOI of 1 TCID50/cell and GM with MOI of higher level, which was stably maintained after NDV GM 0.1 TCID50/cell, respectively. One h after virus adsorption, infection (Fig. 2). the cells were incubated in virus-production medium (basal D-MEM with 2 percent FBS). Supernatants were NDV Promote RelA/p65 Localization in the Nucleus harvested every 12 h and virus titers were determined by It has been reported that RelA/p65 is held quiescent TCID50 on Vero cells. Briefly, Vero cells were seeded in 96- 4 in the cytoplasm in cells. In this study, CEF were infected well plates at a density of 10 cell per well. The following with the NDV of lentogenic strain LaSota or the velogenic day, Vero cells were infected with 100 uL virus samples of strain GM to reveal the subcellular distribution of RelA/ serial tenfold dilutions. One hour after virus adsorption, p65 (green) and the nuclei (blue). RelA/p65 showed a the cells were incubated in D-MEM with 2% FBS for 7 days, predominantly nuclear localization pattern in CEF (Fig. 3, up and then analysed for cytopathic effect to determine [22] two panels). However, in the mock-infected CEF cells, RelA/TCID50, as described previously . p65 was localized predominantly in the cytoplasm (Fig. Statistical Analysis 3, middle panel). In order to further gain insight into the translocation mechanism of RelA/p65, the laser confocal The statistical significance of experiment data was analysis was conducted after CEF cells were treated by determined by Student’s t-test. UV-inactivated NDV strain GM or LaSota for 24 h and the 248 RelA/p65-mediated Innate ... Fig 1. Two stains of NDV alter mRNA levels of IFN-α, IFN-β, STAT1 and RelA/p65 in CEF. After CEF were infected with NDV LaSota or GM at a MOI of 0.1 TCID50/cell, the cells were harvested at 3, 6, 12 and 24 h p.i. Total RNA was extracted and analyzed by qPCR on mRNA levels of IFN-α, IFN-β, STAT1 and RelA/p65. The data were normalized by the internal control, the GAPDH gene, and the fold-change was relative to uninfected cells Şekil 1. İki NDV suşu CEF’teki IFN-α, IFN-β, STAT1 düzeylerini ve RelA/p65’i değiştirir. CEF’nin 0.1 MOI TCID50/ hücre dozda NDV LaSota veya GM ile enfekte edilmesinin ardından, hücreler enjeksiyon sonrası (p.i) 3, 6, 12 ve 24. saatte toplandı. Total RNA mRNA üzerindeki IFN-α, IFN-β, STAT1ve RelA/p65 düzeyleri qPCR ile eksrakte edildi ve analiz edildi. Data iç kontrol ile normalize edildi, GADPH geni ve kat-değişimi non-enfekte hücrelere yakın idi Fig 2. NDV alters the protein expression levels of RelA/p65. CEF were infected with the indicated strains of NDV LaSota or GM (MOI of 0.1 TCID50/cell). Total cellular proteins were harvested at 0.5, 1, 3, 6, 12 and 24 h p.i and separated by SDS-PAGE. A western blotting analysis of proteins resolved by SDS-PAGE was performed with antibodies of RelA/p65 and GAPDH protein. Proteins were quantified with the Odyssey infrared imaging system. RelA/p65 protein band intensities were normalized to GAPDH Şekil 2. NDV RelA/p65 protein ekspresyon düzeylerini değiştirir. CEF, belirtilen NDV LaSota veya GM (0,1 TCID50/hücre MOI) suşları ile enfekte edildi. Toplam hücresel proteinler enjeksiyon sonrası 0.5, 1, 3, 6, 12 ve 24. saatte toplandı ve SDS-PAGE ile ayrıldı. SDS-PAGE ile yeniden çözülmüş proteinlerin RelA/p65 ve GAPDH protein antikorları ile Western blot analizi gerçekleştirildi. Proteinler Odyssey kızılötesi görüntüleme sistemi ile ölçüldü. RelA/p65 protein bandı yoğunlukları GAPDH için normalize edildi results showed that RelA/p65 located predominantly in to normal cells. In order to examine whether RelA/p65 the cytoplasm (Fig. 3, lower two panels). regulates the NF-kB signal, mRNA levels of IFN-α, IFN-β and STAT1 were also detected. Real time PCR showed that Inhibition of RelA/p65 down-regulates IFN-α, inhibition of RelA/p65 also led to the down-regulation of IFN-β and STAT1 the mRNA level of IFN-α, IFN-β and STAT1 by 38, 55 and 61 To confirm the role of RelA/p65 in the NF-kB signal, we percent (Fig. 4). Compared to normal cells, the fold change inhibited RelA/p65 in CEF by specific siRNA. The specific of mRNA levels of RelA/p65, IFN-α, IFN-β and STAT1 were siRNA treatment resulted in significant decline of RelA/ not apparent after treatment cells with non-targeting p65 by 78 percent at the mRNA level in CEF compared siRNA of RelA/p65. 249 WANG, SUN, KANG XIE, REN Fig 3. Subcellular localization of RelA/p65 protein in CEF. CEF were infected by NDV strain LaSota or GM with MOI of 0.1 TCID50/cell, or were treated with UV-inactivated NDV (NDV- UV) strain LaSota or GM for 24 h. After cells were fixed with 4% paraformaldehyde for 15 min, they were incubated with rabbit RelA/p65 antibody at 4°C overnight and then stained with FITC-conjugated goat anti-rabbit antibody. To stain the nuclei, DAPI was added to CEF at room temperature for 10 min. The cells were observed under a laser copolymerization microscope Şekil 3. CEF’de RelA/p65 proteininin hücre-içi lokalizasyonu. CEF ya 0.1 TCID50/hücre MOI doz NDV LaSota veya GM suşu ile enfekte edildi, ya da 24 saat süreyle UV ile etkisizleştirilmiş NDV (NDV-UV) LaSota veya GM suşu ile muamele edildi. Hücreler 15 dak. boyunca %4 paraformaldehit ile fikse edildikten sonra, gece boyunca tavşan RelA/p65 antikoru ile 4°C’de inkübe edildikten sonra FITC-konjügeli keçi anti- tavşan antikoru ile boyandı. Çekirdekleri boyamak amacıyla CEF’e 10 dak. için oda sıcaklığında DAPI ilave edildi. Hücreler bir lazer kopolimerizasyon mikroskobu altında gözlendi Fig 4. Inhibition of RelA/p65 down-regulates the mRNA level of IFN-α, IFN-β, and STAT1. When CEF were grown to 70-80% confluence in 12-well plates, the cells were treated with 40 pM oligonucleotide of RelA/p65 siRNA or control siRNA for 24 h. Then the cells wereæ collected to extract total RNA, the mRNA levels of RelA/p65, IFN-α, IFN-β and STAT1 were determined by qPCR, and the fold-change was relative to normal CEF Şekil 4. RelA/p65 inhibisyonu IFN-a, IFN-p ve STAT1 mRNA düzeyini aşağı-yöne doğru çevirir. CEF 12-yuvalı plakalar içinde %70-80 kaynaşmaya kadar büyütüldüğünde, hücreler RelA/p65 siRNA’nın 40 uM oligonükleotidi veya kontrol siRNA ile 24 saat boyunca işlemden geçirildi. Daha sonra hücreler, toplam RNA elde etmek için toplandı, RelA/p65, IFN-a, IFN-p ve STAT1 mRNA düzeyleri qPCR ile belirlendi ve kat-değişimi normal CEF’e yakındı Fig 5. Inhibition of RelA/p65 enhancement of NDV production kinetics. When CEF were grown to 70-80% confluence in 6-well plates, the cells were treated with 40 pM oligonucleotide of RelA/p65 siRNA or control siRNA for 24 h and were infected by NDV strain GM with MOI of 0.1 and LaSota with MOI of 1 TCID50/ cell, respectively. The cell supernatant was collected at 24, 36, 48, 60 and 72 h p.i., and TCID50 was determined on Vero cells Şekil 5. NDV üretim kinetiğinin RelA/p65 artışını engellemesi. CEF 6-yuvalı plakalar içinde %70-80’lik bir kaynaşmaya kadar büyütüldüğünde, hücreler 40 uM RelA/p65 siRNA oligonükleotidi veya kontrol siRNA ile 24 saat boyunca işlemden geçirildi ve sırasıyla 0.1 MOI NDV LaSota ve 1 TCID50/ hücre MOl GM suşu ile enfekte edildi. Hücre süpernatantı enjeksiyon sonrası 24, 36, 48, 60 ve 72. saatte toplandı ve Vero hücrelerindeki TCID50 belirlendi Inhibition of RelA/p65 Enhance NDV Replication DISCUSSION To investigate the effect of RelA/p65 signals on virus production, after CEF were treated with RelA/p65 siRNA for The early response to a virus causes host activation of 24 h, the cells were infected with NDV strain GM or LaSota. transcription factors NF-κB, interferon regulatory factors The cell supernatants were collected to examine the virus- (IRFs) and activator protein-1 (AP-1) (ATF-2/c-jun) through production kinetics on Vero cells. In our study, whether pattern recognition receptors (PRRs), recognized pathogen- the NDV strain velogenic GM or lentogenic LaSota, if RelA/ associated molecular patterns (PAMPS), and further results p65 had been inhibited in advance, the virus-production in secretion IFNs [23-25]. Once type I IFN are synthesized, they kinetics were higher than that of the control group act in both an autocrine and paracrine manner during 36 h p.i (Fig. 5). the innate immune response to retard virus replication by 250 RelA/p65-mediated Innate ... activating the Janus kinase/signal transducer and activator that NDV could activate the RelA/p65 signal and induce of transcription (JAK/STAT) signal transduction cascade, the RelA/p65 protein shift from the cytoplasm to the leading to the activation of ISGs to further limit virus nucleus while inactivated NDV did not exert this function replication [7,26,27]. in CEF, which suggesting that the nuclear translocation of RelA/p65 is probably related to virus replication. As a subunit of the heterodimeric NF-kB protein, RelA/ p65 plays an essential role in immune response. Virus entry In order to further determine the role of the RelA/p65 in the host can lead to the activation of RelA/p65 and then signal to different NDV replications, we knocked down RelA/ the activation of IFN-α/β genes via the RelA/p65 signal [28-30]. p65 with a specific siRNA in CEF. Real time PCR showed that However, the research of the RelA/p65 signal in animal the inhibition of RelA/p65 also led to down-regulating the virus infections has been limited to mammals or their cell, mRNA level of IFN-α, IFN-β and STAT1. The results further it is rare to study the effect of the signal on viral replication indicated that RelA/p65 played an important role in the in birds, especially, the action of the RelA/p65 signal on process of anti-viral actions. Subsequent studies revealed NDV replication in CEF. Based on these considerations, we that the NDV production kinetics were enhanced after the chose cell CEF as the primary cell to research the change inhibition of RelA/p65 in CEF. The results indicated that of the RelA/p65 signal after NDV infection, and chose a RelA/p65-mediated signaling pathway could limit NDV Vero cell which is deficient in interferon production to replication and that RelA/p65 played an important role in support efficient production of NDV for studying anti- the process of anti-viral actions. viral responses. This study showed that a RelA/p65-mediated signaling In vitro or in vivo experiments suggest that a pronounced pathway could be activated after CEF were infected by NDV, and rapid innate immune response may be induced by and this change in the signal could limit the replication NDV. In this study, we measured mRNA levels of IFN-α, of NDV. Therefore, this finding will provide a theoretical IFN-β, STAT1 and RelA/p65 in NDV-infected CEF. Our study foundation of the pathogenic mechanism in RelA/p65- showed that the mRNA levels of RelA/p65, IFN-α and IFN-β mediated hosts’ innate immune responses caused by NDV. are increased obviously after lentogenic or velogenic NDV infection CEF, and correspondingly, the mRNA level of Acknowledgments STAT1 was also increased. These results are in agreement with previous studies [20,21], but we also found that lento- This work was supported by a grant from the National genic and velogenic NDV have different ability to induce Natural Science Foundation of China (No. 30200011) and CEF express IFN-α, IFN-β, STAT1 and RelA/p65. An important the Specialized Research Fund for the Doctoral Program reason perhaps interrelated to V protein of NDV which of Higher Education of China (20124404110016). functions as an IFN-α/β antagonist by targeting STAT1 for degradation [2,5,6] REFERENCES . The difference of V proteins derived from the velogenic NDV-GM and the lentogenic NDV- 1. Alexander DJ: Newcastle disease and other avian paramyxoviruses. LaSota maybe have different ability to target STAT1, and Rev Sci Tech, 192, 443-462, 2000. which is worthy of further study. The other reason could 2. Huang Z, Panda A, Elankumaran S, Govindarajan D, Rockemann be interrelated to apoptosis. NDV is known to cause DD, Samal SK: The hemagglutinin-neuraminidase protein of Newcastle disease virus determines tropism and virulence. J Virol, 78, 4176-4184, apoptosis in different cell types including CEF cells, Vero 2004. DOI: 10.1128/JVI.78.8.4176-4184.2004 cells and peripheral blood mononuclear cells, NDV-induced 3. Steward M,Vipond IB, Millar NS, Emmerson PT: RNA editing apoptosis required virus entry and replication [31-33], different in Newcastle disease virus. J Gen Virol, 74, 2539-2547, 1993. DOI: apoptosis rate induced by lentogenic and velogenic NDV 10.1099/0022-1317-74-12-2539 maybe leading to differences of the protein production 4. Huang Z, Krishnamurthy S, Panda A, Samal SK: Newcastle disease synthesized by CEF. virus V protein is associated with viral pathogenesis and functions as an alpha interferon antagonist. J Virol, 77, 8676-8685, 2003. DOI: 10.1128/ On the basis of the above research, Western blot analysis JVI.77.16.8676-8685.2003 was carried out to demonstrate the protein level of RelA/ 5. Nishio M, Tsurudome M, Ito M, Garcin D, Kolakofsky D, Ito Y: Identification of paramyxovirus V protein residues essential for STAT p65 in NDV-infected CEF. The results showed that NDV protein degradation and promotion of virus replication. J Virol, 79, 8591- could induce CEF to synthesize more RelA/p65 protein, 8601, 2005. DOI: 10.1128/JVI.79.13.8591-8601.2005 but different virulent NDVs have different capabilities 6. Park MS, Garcia-Sastre A, Cros JF, Basler CF, Palese P: Newcastle to activating RelA/p65-mediated signaling pathways.  After disease virus V protein is a determinant of host range restriction. J Virol, completing above study, we performed immunofluorescence 77, 9522-9532, 2003. DOI: 10.1128/JVI.77.17.9522-9532.2003 staining to confirm the subcellular localization of RelA/ 7. Honda K, Takaoka A,Taniguchi T: Type I interferon gene induction by p65. Immunofluorescence staining demonstrated that the interferon regulatory factor family of transcription factors. Immunity, 25, 349-360, 2006. DOI: 10.1016/j.immuni.2006.08.009 RelA/p65 protein had a predominantly nuclear localization 8. Sharma S, tenOever BR, Grandvaux N, Zhou GP, Lin R, Hiscott J: pattern in NDV-infected cells. While for the mock-infection Triggering the interferon antiviral response through an IKK-related CEF and NDV-UV treatment group, the RelA/p65 protein pathway. Science, 300, 1148-1151, 2003. DOI: 10.1126/science.1081315 was mainly distributed to the cytoplasm. The study showed 9. Yoneyama M, Suhara W, Fukuhara Y, Fukuda M, Nishida E, Fujita 251 WANG, SUN, KANG XIE, REN T: Direct triggering of the type I interferon system by virus infection: interferon alpha on infectious bursal disease virus and Newcastle disease Activation of a transcription factor complex containing IRF-3 and CBP/ virus infection. Avian Dis, 45, 389-399, 2001. DOI: 10.2307/1592978 p300. EMBO J, 7, 1087-1095, 1998. DOI: 10.1093/emboj/17.4.1087 22. Hamilton MA, Russo RC, Thurston RV: Trimmed Spearman- 10. Chakraborty JB, Mann DA: NF-kappaB signaling: embracing Kärber CPE method for estimating median lethal concentrations in complexity to achieve translation. J Hepatol, 52, 285-291, 2010. DOI: toxicity bioassays. Environ Sci Technol, 13, 714-719, 1977. DOI: 10.1021/ 10.1016/j.jhep.2009.10.030 es60130a004 11. Chen LF, Greene WC: Shaping the nuclear action of NF-kappaB. Nat 23. Dey N, Liu T, Garofalo RP, Casola A: TAK1 regulates NF-KappaB and Rev Mol Cell Biol, 5, 392-401, 2004. DOI: 10.1038/nrm1368 AP-1activation in airway epithelial cells following RSV infection. Virology, 12. Kato H, Takeuchi O, Sato S: Differential roles of MDA5 and RIG-I 418, 93-101, 2011. DOI: 10.1016/j.virol.2011.07.007 helicases in the recognition of RNA viruses. Nature, 441, 101-105, 2006. 24. Hayden MS, Ghosh S: Shared principles in NF-kappaB signaling. Cell, DOI: 10.1038/nature04734 132, 344-362, 2008. DOI: 10.1016/j.cell.2008.01.020 13. Liu P, Jamaluddin M, Li K, Garofalo RP, Casola A, Brasier AR: 25. Hiscott J: Convergence of the NF-kB and IRF pathways in the Retinoic acid-inducible gene I mediates early antiviral response and Toll- regulation of the innate antiviral response. Cytokine Growth Factor Rev, 18, like receptor 3 expression in respiratory syncytial virus-infected airway 483-490, 2007. DOI: 10.1016/j.cytogfr.2007.06.002 epithelial cells. J Virol, 81, 1401-1411, 2007. DOI: 10.1128/JVI.01740-06 26. Pansky A, Hildebrand P, Fasler-Kan E: Defective Jak-STAT signal 14. Loo YM, Fornek J, Crochet N, Bajwa G, Perwitasari O, Martinez- transduction pathway in melanoma cells resistant to growth inhibition Sobrido L, Akira S, Gill MA, Garcı´a-Sastre: Distinct RIG-I and MDA5 by interferon-alpha. Int J Cancer, 85, 720-725, 2000. DOI: 10.1002/ signaling by RNA viruses in innate immunity. J Virol, 82, 335-345, 2008. (SICI)1097-0215(20000301)85:5<720::AID-IJC20>3.0.CO;2-O DOI: 10.1128/JVI.01080-07 27. Thoennissen NH, Iwanski GB, Doan NB, Okamoto R, Lin P, Abbassi 15. Zhang G, Ghosh S: Toll-like receptor-mediated NF-kappaB activation: S, Song JH, Yin D, Toh M, Xie WD, Said JW, Koeffler HP: Cucurbitacin B Aphylogenetically conserved paradigm in innate immunity. J Clin Invest, induces apoptosis by inhibition of the JAK/STAT pathway and potentiates 107, 13-19, 2001. DOI: 10.1172/JCI11837 antiproliferative effects of gemcitabine on pancreatic cancer cells. Cancer 16. Kiernan R, Bres V, Ng RW, Coudart MP, Messaoudi S: Post- Res, 69, 5876-5884, 2009. DOI: 10.1158/0008-5472.CAN-09-0536 activation turn-off of NF-kappaB-dependent transcription is regulated by 28. Chen LF, Mu Y, Greene WC: Acetylation of RelA at discrete sites acetylation of p65. J Biol Chem, 278, 2758-2766, 2003. DOI: 10.1074/jbc. regulates distinct nuclear functions of NF-kappaB. EMBO J, 21, 6539-6548, M209572200 2002. DOI: 10.1093/emboj/cdf660 17. Schmitz ML, Baeuerle PA: The p65 subunit is responsible for the 29. Sethi G, Sung B, Aggarwal BB: Nuclear factor-kappaB activation: strong transcription activating potential of NF-kappaB. EMBO J, 10, 3805- From bench to bedside. Exp Biol Med, 233, 21-31, 2008. DOI: 10.3181/0707- 3817, 1991. MR-196 18. Ahmed KA, Saxena VK, Ara A, Singh KB, Sundaresan NR, Saxena 30. Vallabhapurapu S, Karin M: Regulation and function of NF-kappaB M, Rasool TJ: Immune response to Newcastle disease virus in chicken lines transcription factors in the immune system. Annu Rev Immuno, l27, 693- divergently selected for cutaneous hypersensitivity. Int J Immunogenet, 733, 2009. DOI: 10.1146/annurev.immunol.021908.132641 34, 445-455, 2007. DOI: 10.1111/j.1744-313X.2007.00722.x 31. Geisler F, Algul H, Paxian S, Schmid RM: Genetic inactivation of 19. Sick C, Schultz U, Mu ¨nster U, Meier J, Kaspers B, Staeheli P: RelA/p65 sensitizes adult mouse hepatocytes to TNF-induced apoptosis Promoter structures and differential responses to viral and nonviral in vivo and in vitro. Gastroenterology, 132, 2489-2503, 2007. DOI: 10.1053/j. inducers of chicken type I interferon genes. J Biol Chem, 273, 9749-9754, gastro.2007.03.033 1998. DOI: 10.1074/jbc.273.16.9749 32. Lam KM: Apoptosis in chicken embryo fibroblasts caused by 20. Cary AR, Leonardo S, Ingrid C, Corrie CB, Darrell RK, David LS, Newcastle disease virus. Vet Microbiol, 47, 357-363, 1995. DOI: 10.1016/ Daniel JK, Patti JM, Claudio LA: Virulent Newcastle disease virus elicits 0378-1135(95)00111-5 a strong innate immune response in chickens. J Gen Virol, 92, 931-939, 33. Lam KM: Newcastle disease virus-induced apoptosis in peripheral 2011. DOI: 10.1099/vir.0.025486-0 blood mononuclear cells of chickens. J Comp Pathol, 114, 63-71, 1996. 21. Mo CW, Cao YC, Lim BL: The in vivo and in vitro effects of chicken DOI: 10.1016/S0021-9975(96)80063-6 Kafkas Univ Vet Fak Derg KafKas Universitesi veteriner faKUltesi Dergisi 22 (2): 253-260, 2016 JoUrnal Home-Page: http://vetdergi.kafkas.edu.tr Research Article DOI: 10.9775/kvfd.2015.14390 online sUbmission: http://vetdergikafkas.org Effects of Different Levels of Essential Oil Mixed (Peppermint- Thyme-Anise Oil) Supplementation in the Drinking Water on the Growth Performance, Carcass Traits and Histologic Structure of Terminal Ileum in Quails [1] Özlem KARADAĞOĞLU 1 Kadir ÖNK 1 Tarkan ŞAHİN 2 Seyit Ali BİNGÖL 3 Dilek Aksu ELMALI 4 Özlem DURNA 5 [1] This study was presented as a poster in VIIth National Animal Nutrition Congress which was held in September of 26-27, Ankara, 2013 in Turkey 1 Department of Agriculture and Animal Production, Kars Vocational High School, University of Kafkas, TR-36100 Kars - TURKEY; 2 Department of Animal Nutrition and Nutritional Diseases, Faculty of Veterinary, University of Kafkas, TR-36100 Kars - TURKEY; 3 Kars School of Health Sciences, Kafkas University, TR-36000 Campus, Kars - TURKEY; 4 Department of Animal Nutrition and Nutritional Diseases, Faculty of Veterinary, University of Mustafa Kemal, TR-31040 Hatay - TURKEY; 5 Department of Animal Nutrition and Nutritional Diseases, Faculty of Veterinary, University of Ankara, TR-06100 Ankara - TURKEY Article Code: KVFD-2015-14390 Received: 15.09.2015 Accepted: 04.11.2015 Published Online: 04.11.2015 Abstract This study was conducted in order to define the effects of oregofarm (peppermint, thyme and anise oil) supplementation in the drinking water on the growth performance, carcass quality and histologic structure of terminal ileum in quails. A total of 348 Japanese quail chicks (Coturnix coturnix japonica) of both sexes were included in this study. They were divided into one control group and two experimental groups and each of them contained 116 Japanese quail chicks. Each group was further divided into four subgroups with 29 Japanese quail chicks. This study was finalized in six weeks. All groups were fed with basal diets and received fresh water during the experiment. The control group received non-supplemented water. The group 1 and 2 received 1.0 ml/5 L and 1.5 ml/5 L oil mixture, respectively. All experimental groups were fed with water and ad-libitum. As a result of the study, there were statistically significant differences between the feed consumption and efficiency (P<0.001) in the end of the three weeks. Similarly, there were also statistically significant differences between same parameters (P<0.01; 0.05) five weeks later. The body weights of quails were not significantly different from each other (P>0.05). At the end of the study, there were statistically differences in the warm and cold carcass parameters (P<0.05). Adding essential oil mixed were not affected on histological structure of terminal ileum (P>0.05). Conclusively, the supplementation of oregofarm (peppermint + thyme and anise oil) has no additional effect on quail performance. Keywords: Quail, Essential oil mixed, Performance, Carcass, Ileum İçme Suyuna Farklı Düzeylerde İlave Edilen Esansiyel Yağ Karışımının (Nane-Kekik-Anason Yağı) Bıldırcınlarda Büyüme Performansı, Karkas Parametreleri ve İleumun Histolojik Yapısı Üzerine Etkileri Özet Bu araştırma, bıldırcın içme suyuna oregofarm (nane-kekik-anason yağı) ilavesinin büyüme ve besi performansı, karkas özellikleri ve ileumun histolojik yapısı üzerine etkisini belirlemek amacıyla yapılmıştır. Araştırmada her iki cinsiyette toplam 348 adet Japon bıldırcın (Coturnix coturnix japonica) civcivi kullanılmıştır. Her grupta 116 civciv bulunan 1 kontrol 2 deneme grubu oluşturulmuştur. Gruplar kendi aralarında 4’erli alt gruba ayrılmıştır ve her alt grup 29 adet civcivden oluşturulmuştur. Deneme altı hafta sürdürülmüştür. Bütün deneme grupları temel rasyonla beslenmiştir ve deneme boyunca temiz içme suyu sağlanmıştır. Kontrol grubunun içme suyuna oregofarm ilavesi yapılmamıştır. 1. deneme grubu ve 2. deneme grubu içme suyuna sırasıyla 1.0 mg/5 L ve 1.5 mg/5 L. oregofarm ilavesi yapılmıştır. Tüm deneme gruplarına yem ve su ad-libitum olarak verilmiştir. Araştırma sonunda, yem tüketimi ve yemden yararlanma oranı bakımından 3. haftada istatistiksel açıdan önemli farklılıklar (P<0.001) gözlenmiş olup, benzer şekilde 5. haftada da aynı değerler bakımından farklılıklar tespit edilmiştir (P<0.01; 0.05). Denemede canlı ağırlıklar bakımından gruplar arasında istatistiksel olarak herhangi bir farklılık gözlenmemiştir (P>0.05). Denemenin sonunda gruplar arasında sıcak ve soğuk karkas parametreleri bakımından istatistiksel olarak farklılıklar bulunmuştur (P<0.05). Esansiyel yağ ilavesinin ileumun termal yapısı üzerine etkisi görülmemiştir (P>0.05). Sonuç olarak, bıldırcın içme suyuna oregofarm ilavesinin performansı artırıcı ilave bir etkisinin olmadığı tespit edilmiştir. Anahtar sözcükler: Bıldırcın, Esansiyel yağ karışımı, Performans, Karkas, İleum  İletişim (Correspondence)  +90 474 2123623/125; Fax: +90 474 2239957  drozlemkaya@hotmail.com 254 Effects of Different Levels ... INTRODUCTION Kafkas University Animal Testing Local Ethics Council (Approval Number: KAÜ-HADYEK/2012-53). For several years, the dietary use of antibiotics has been extensively used throughout the world as growth Japanese quails (Coturnix coturnix japonica) bred in the promoters in animal feeds, particularly in poultry products [1]. test unit of Kafkas University Research and Application However, many countries have banned the use of Center. A total of 348 Japanese quail chicks were used in antibiotics in animal feed as an additive since their use may this study. They were divided into one control group and lead to the antibiotic resistant bacteria which are harmful two experimental groups each containing 116 Japanese to humans [2-4]. Therefore, nutritionists and production quail chicks. Each group was divided into four subgroups managers have to find alternatives which have potential and each subgroup contained 29 Japanese quail chicks. All to alleviate the problems related to the withdrawal of groups were fed ad-libitum with a 23% crude protein and antibiotics from diets and reduce enteric diseases in the 3080 kcal/kg metabolize energy diet. The quails received poultry [5,6]. Various studies have currently focused on the fresh water during the experiment. The control group of research on natural feed additives in animal diets such quails received non-supplemented water. The group 1 as antioxidant [7,8], anticoccidial [9,10] or antimicrobial [11,12] and 2 received 1.0 and 1.5 ml/5 L oil mixture, respectively. plants. Recently, food additives with plant origin such as The active components of mixture is presented in Table 1 essential oils, have received considerable attention since (Oregofarm, FARMAVET AS). It contains peppermint, thyme substitutes for antibiotics are being used as a growth and anise. The composition of basal diet is presented in promoters [13]. Consequently, some plants have attracted Table 2. The experimental period lasted in 42 days. The ratios increasing interest since they have an alternative feed were isocaloric and isonutrigenos. Diets were formulated additivies (antimicrobial, antiparaziter, anticancer, anti- to meet the NRC [31] nutrient requirements. oxidant, antistress and appetizing) and they can replace antibiotic growth promoters [14]. Table 1. The active components of the essential oil mixture Peppermint is a member of the Labiatae family and it Tablo 1. Esansiyel yağ karışımının aktif bileşenleri is possibly originated from Eastern Asia. It is used widely Components (mg/kg) in herbal medicine and it is believed to be beneficial Thymol (thyme oil) 2000 particularly for the immune system. The most abundant B-phellanderene (thymeoil) 1300 constituent of peppermint is menthol, which has anti- [15] Limonene (thyme oil+pepermint oil) 3525bacterial features . Peppermint is also rich source of polyphenolic compounds and hence, it could possess strong B-pinene (thyme oil+pepermit oil) 1977 antioxidant properties [16,17]. Anise (Pimpinella anisum L.) is Carvacrol (oreganum oil) 8910 an annual aromatic plant belonging to the Apiaceae family. Linalool (oreganum oil) 3645 It has been used over the years due to its antioxidant [18], Anethole (anise oil) 10712 antimicrobial [19], antibacterial [20] and antifungal [21] properties. Menthole (pepermint oil) 6375 Thymus vulgaris L. (thyme) is also an aromatic plant belonging to Lamiaccea family. It has been a subject of considerable interest as a medicinal and therapeutic agent Table 2. Composition and calculated analysis of basal diet worldwide [22]. The pharmacological effect of thyme is Tablo 2. Temel rasyonun bileşimi ve hesaplanan analiz değerleri attributed to carvacrol and thymol which are main bio- Ingredients (%) Values Analysed (% ) active components of thyme [23]. Thymol and carvacrol have Corn 50.62 Dry Matter 90.90 considerable antimicrobial and antifungal activity [24,25]. Furthermore, they have also been reported to have anti- Soybean meal 42.16 Crude Protein 23.02 oxidant properties as well as antibacterial activity against Oil 4.17 Crude Extract 6.56 a wide range of bacteria [26,27]. Limestone 1.34 Crude Ash 3.37 Dicalcium phosphate 1.09 Crude Fiber 2.37 In recent years, there have been numerous studies about ** essential oil supplementation of dietary on poultry [28-30]. Salt 0.18 ME, kcal/kg 3080.88 But as we know, there have not been any study Vitamin-mineral prem.* 0.20 Ca 0.95 supplementation of essential oil mixed in drinking water Sodium Bicarbonate 0.08 P 0.66 on poultry performance. The aim of the present study is to DL-methionine 0.14 evaluate the effects of oregofarm (peppermint, thyme and L-Lysine 0.02 anise oils) supplementation in drinking water of quails on the growth performance and carcass quality. Total 100 * Each 1 kg of Vit-min premix includes 20.000.000 IU Vit A, 3.000.000 IU Vit D3, 25 g Vitamin E, 4 g Vitamin B1, 8 g Vitamin B2,2.5 g Vitamin B , 20 MATERIAL and METHODS 6mg Vitamin B12, 20 g Nicotinamid, 12 g Calcium-D-pantothenate, 200 g Choline Chloride, 50 g Mangane, 50 g Iron, 50 g Zinc, 10 g Copper, 0.8 g This research was conducted after the approval of Iodine, 0.15 g Cobalt, 0.15 g Selenium; ** Calculated nutritional values 255 KARADAĞOĞLU, ÖNK, ŞAHİN BİNGÖL, ELMALI, DURNA Crude nutrients in feed and experimental ratio were USA) program. For ileum samples One-Way ANOVA in analyzed using AOAC [32] method. The levels of metabolic PASW statistic 18 programe was used for statistical energy were calculated by using the formula developed calculations. by TSE [33]. At beginning (0 day) and on the 7th 14th 21st, 28th, 35th and 42nd day of the study, the body weight and RESULTS body weight gain of the quails were recorded. Meanwhile, the whole feed residues of the subgroups were weighed The effects of drinking-water supplementation with weekly in order to measure feed consumptions and feed peppermint+thyme and anise oils for 42 days on growth conversion ratios. performance are shown in Table 3. The body weight Eleven male and eleven female birds from each sub- of quail chicks was not significantly influenced by the groups, a total of 132 chicks were randomly selected and essential oil supplementation (P>0.05). Body weight slaughtered in order to determine their carcass quality. (BW), body weight gain (BWG), feed consumption (FC) Then, animals were gained again and warm carcass and feed conversion ratio (FCR) are shown Table 4. Feed weight was recorded. Cold carcass weight was determined consumption in control group which was not fed with upon keeping the carcasses at +4ºC for 18 h. Cold carcass essential oils was found to be higher compared to the weight divided by the slaughter weight was calculated to feed consumption of experimental groups. Furthermore, determine cold carcass yield. the feed consumption was significantly affected by essential oils and it was found to be lower than the feed The ileums were taken from 6 animals of each group consumption of the control group (P<0.01; 0.001). In the to examine histological. The tissues were fixed in alcohol fifth weeks, BWGs in group II were higher when compared formaldehyde then were passed series of solution which to other experimental groups (P<0.01). When compared are used for routine histological process, and were to other groups, feed conversion ratio was markedly low embedded in paraffin. Sections taken from paraffin blocks (P<0.05; 0.001) in the group II (1.5 ml/5 L oregofarm) were put on the slides and were stained with Hematoxylin during the 3rd and 5th weeks. The overall FCR, calculated for Eosin (HE) and Periodic Acid Schiff (PAS) then slides were the 6 weeks, was significantly lower than the overall FCR examined by light microscopy (Olympus BX-51) [34]. Length of other experimental groups (P<0.05). As shown in Table and width of villusses were measured by a micrometer and 5, the drinking water supplementation with essential oils for this measurements were chosen 6 adjoining villusses at statistically affected the slaughter weight, warm and cold random per ileum. For villus length were taken into account between top point of ileal crypts and top of villus [35]. carcass (P<0.05). For width of villus was taken into account in the middle of It was observed that ileum tissues were histological the villus. similar in all groups (Fig. 1, 2, 3). In Table 6, between groups, Statistical analyses were performed and the significance width and length of villusses were statistically determined of the difference between the mean scores of the groups to be similar in all groups (P>0.05). for body weight, body weight gain, feed consumption, feed conversion ratio, carcass weight and yield were DISCUSSION determined by using the variance analysis method. Significant differences between the mean values of According to our study, the oregofarm supplementation different treatments were determined by using the in the drinking water did not lead to statistically significant Duncan’s multiple range tests. The statistical analysis difference between experimental groups in terms of live was conducted by using the SPSS 16.0 (Inc. Chicago. IL. body weights (P>0.05) (Table 3). In terms of the results Table 3. Mean body weights of the groups (g) Tablo 3. Gruplarda ortalama canlı ağırlıklar (g) Weeks n Control n Group I n Group IIX±Sx X±Sx X±S P x 0 116 8.41±0.08 116 8.38±0.08 116 8.38±0.07 - 1 108 14.13±0.31 107 14.07±0.34 106 13.13±0.30 - 2 100 32.43±0.94 98 33.61±0.91 100 32.30±0.89 - 3 98 65.51±1.44 95 65.78±1.48 93 65.34±1.47 - 4 97 101.33±1.92 94 100.78±1.94 91 102.98±1.87 - 5 97 140.23±2.28 94 136.71±2.37 91 142.29±2.38 - 6 96 158.88±2.48 94 155.31±2.44 91 159.27±2.77 - -: Differences among the groups were not statistically significant (P>0.05) 256 Effects of Different Levels ... Table 4. Mean feed consumption, weekly body weight gain and feed conversion rate* values of groups Tablo 4. Gruplarda ortalama yem tüketimi, haftalık canlı ağırlık artışı ve yemden yararlanma oranı* Weeks Parameters Control Group I Group IIX±Sx X±S P x X±Sx FC (g/chick) 10.01±0.23 10.12±0.45 10.19±0.18 - 1 BWG (g) 5.73±0.39 5.69±0.17 4.87±0.36 - FCR 1.77±0.11 1.78±0.07 2.12±0.14 - FC (g/chick) 48.43±1.47 49.43±3.12 44.51±3.03 - 2 BWG (g) 18.19±0.56 19.14±0.56 20.39±2.01 - FCR 2.67±0.10 2.58±0.11 2.77±0.33 - FC (g/chick) 94.59±1.46a 93.81±1.22a 74.12±1.64b *** 3 BWG (g) 32.76±0.40 32.13±0.70 32.16±0.71 - FCR 2.89±0.02a 2.92±0.05a 2.31±0.06b *** FC (g/chick) 120.34±1.02 117.71±4.63 112.09±1.91 - 4 BWG (g) 36.46±0.83 35.22±0.94 36.27±0.45 - FCR 3.50±0.11 3.34±0.12 3.09±0.06 * FC (g/chick) 157.51±6.10a 141.99±1.50b 144.17±2.32b ** 5 BWG (g) 39.27±0.24ab 35.98±0.80b 40.46±1.89a * FCR 4.01±0.14a 3.95±0.08b 3.58±0.12b * FC (g/chick) 141.16±1.01 139.72±4.94 137.91±1.81 - 6 BWG (g) 18.72 ±1.42 18.35±1.24 20.77±4.30 - FCR 7.80±0.66 7.72±0.57 7.32±1.10 - FC (g/chick) 574.04±8.15a 552.77±12.12a 522.97±3.25b ** 1-6 BWG (g) 150.44±3.02 146.94±1.67 155.34±6.89 - FCR 3.82±0.09a 3.76±0.05a 3.38±0.13b * a,b: Mean values on the same row followed by different letters change significantly (P<0.05, 0.01, 0.001; respectively); -: Differences among the groups were not statistically significant (P>0.05); * (kg, feed consumption/kg, body weight gain); FC: Feed Consumption, BWG: Body Weight Gain, FCR: Feed Conversion Rate Table 5. Mean slaughter weight , carcass weight and carcass yields of groups Tablo 5. Grupların ortalama kesim ve karkas ağırlıkları ile karkas randımanları Parameters Control Group I Group IIX ± Sx X ± Sx X ± S P x Slaughter weight (g) 153.89±3.68a 141.62±3.51b 143.75±3.90ab * Warm carcass (g) 114.04±2.45a 105.26±2.59b 106.40±2.52b * Cold carcass (g) 111.80±2.43a 102.87±2.54b 103.74±2.47b * Warm carcass percentage (%) 74.32±0.01 74.39±0.01 74.40±0.01 - Cold carcass percentage (%) 72.84±0.01 72.67±0.01 72.53±0.01 - a,b: Mean values on the same row followed by different letters change significantly (P<0.05); -: Differences among the groups were not statistically significant (P>0.05) Table 6. The effect of different levels essential oil mixed on histologic of the live body weight gain, there was a statistically structure of terminal ileum in Japonese quails significant difference between the groups in the 5th week Tablo 6. Japon bıldırcınlarında farklı düzeylerde essensiyel yağ karışımı (P<0.05). These findings are different from the results ilavesinin ileumun termal yapısı üzerine etkisi of the study performed by Biricik et al.[13] in which they Treatment n Villus Length (µm) examined the effects of essential oil supplementation Control ( X ± Sx) 36 315.72±61.50 in the quail diets on the live body weight. However, live Group I ( X ± S ) 36 298.00±43.49 body weight gain results were similar to each other. In the x study conducted by Parlat et al.[36] in which they searched Group II ( X ± Sx) 36 311.27±56.54 the effects of the supplementation of virginiamycine and SEM 0.359 thyme essential oils in the diet. According to their results, Treatment n Villus Width (µm) the best results were obtained from quail groups which Control ( X ± Sx) 36 84.47±15.40 were fed with thyme essential oils. Denli et al.[37] performed Group I ( X ± Sx) 36 83.41±14.64 a study with Japan quails and it has been shown that the Group II ( X ± S ) 36 79.77±13.69 thyme essential oil supplementation enhanced live body x weight as well as live body weight gain according to the SEM 0.362 control group. The supplementation of the thyme + anise Differences among the groups were not statistically significant (P>0.05) and rosemary extracts was shown by Tucker et al.[38] 257 KARADAĞOĞLU, ÖNK, ŞAHİN BİNGÖL, ELMALI, DURNA Fig 1. Villusses could be observed in group 1. HE, X20. Bar 100 µm Şekil 1. Grup 1’de villusların görünümü. HE, X20. Bar 100 µm Fig 2. Vilusses and goblet cells could be observed in group 2. PAS, X20. Bar 100 µm Şekil 2. Grup 2’de villusların ve kadeh hücrelerinin görünümü.  PAS, X20. Bar 100 µm that they increased the live body weight of broilers and anise oil was supplemented. Therefore, they stated that decrease the death rate. Celik [39] have indicated that the anise oil can be used as a growth factor [40]. When the thyme different amounts of essential oil mixtures (mint + juniper + oil was added to the diet as an alternative to antibiotics, rosemary + thyme) supplemented in the diet of broilers the maximum live body weight was obtained in a group did not affect the live body weight whereas enhanced in which the thyme oil and antibiotics were supplemented the death rate. These results are similar to the results of together [41]. The differences between the studies can be our study. due to the different species of animals, different usage of the extracts as well as the diets. In a study, different doses of anise essential oil as an alternative to antibiotics were supplemented in the diet When the feed consumption and the rate of the feed of broilers and it has been shown that the maximum live of groups were assessed, it has been seen that there was a body weight was reached when the maximum dose of significant differences between groups starting from the 3rd 258 Effects of Different Levels ... Fig 3. Cross-section of villusses, and goblet cells (arrows) could be observed in control group. PAS, X20. Bar 100 µm Şekil 3. Kontrol grubu villusların enine kesiti ve kadeh hücrelerinin (oklar) görünümü. PAS, X20. Bar 100 µm week (P<0.001; 0.01) (Table 4). It has been detected that the The length and the width of villus and villus goblet cell feed consumption decreased with the supplementation number are shown figures 1 to 3. It has been observed that of the mint, thyme and anise essential oil mixture in the there was no statistically significant difference between drinking water. Harnandez et al.[42] have reported that the experimental and the control groups related to the the different two plant extract mixtures did not have a length and the width of the villus when the essential oil prominent effect on the feed consumption and the rate mixed are added to the drinking water of quails (P>0.05) of feed. Similarly, Tucker et al.[38] have specified that the (Table 6). Our results are similar to the results of Cabuk thyme and mint oil mixtures did not have an impact on et al.[46]. In contrast to the present result, Denli et al.[37] the rate of feed of the broilers. Biricik et al.[13] performed reported that including thyme and black seed essential a study in which they have indicated that essential oil oil in the diet increases intestinal weight and intestinal supplementation in quail diet did not influence statistically length in quails. These differences, due to adding different the feed consumption. Our results are not consistent with essential oil composition and added shape. these findings. According to the study performed by Halle et al.[43] thyme and thyme essential oil supplementation Conclusively, essential oils or their mixtures have been in the diets of broilers decreased the feed consumption supplemented in the diet in studies have been performed and the essential oil prominently enhanced the rate of till now. In these studies, it has been aimed to examine feed. Our study is in agreement with the study obtained their effects by adding them in the drinking water of by Ghazaghi et al.[44] in which they worked with quails. animals. It has been shown that the addition of the Similarly, Sengün et al.[45] added thyme extract in the diet essential oil mixtures in the drinking water of the quails of quails and they observed the improvement in the decreases the feed consumption, enhances the rate of rate of feed. feed, and decreases the death rate. The supplementation do not have so much effect on live body weight and When the quails were evaluated about their carcass carcass yield whereas it has positive and prominent effects characteristics, there was a statistically significant difference on the digestive system under the poor environmental between experimental and control groups in terms of conditions and malnutrition. Thus, further studies should slaughter, hot and cold carcass weights (P<0.05) (Table be performed with different doses and under different 5). According to Ghazaghi et al.[44] there was no difference animal husbandry systems. between the quail groups in terms of their slaughter weights. There was no significant difference between REFERENCES groups related to their hot and cold carcass yields (P>0.05). Likewise, Biricik et al.[13] have reported that the essential oil 1. Cabuk M, Eratak S, Alcicek A, Bozkurt M: Effects of herbal essential supplementation in the diet of quails did not influence the oil mixture as dietary supplement on egg production in quail. Sci World J, Article ID 573470, 2014. DOI: 10.1155/2014/573470 hot and cold carcass yields. Because of these differences, 2. Knudsen KEB: Development of antibiotic resistance and options to due to adding different essential oil composition and replace antimicrobials in animal diets. Proc Nutr Society, 60, 291-299, 2001. added shape. DOI: 10.1079/PNS2001109 259 KARADAĞOĞLU, ÖNK, ŞAHİN BİNGÖL, ELMALI, DURNA 3. Hayes DJ, Jensen HH: Lesson can be learned from Danish antibiotic 22. Mehdipour Z, Afsharmanesh M, Sami M: Effects of supplemental ban. Feed Stuffs, 75 (37): 17-18, 2003. thyme extract (Thymus vulgaris L.) on growth performance, intestinal 4. Khaksar V, Krimpen MV, Hashemipour H, Pilevar M: Effects of thyme populations and meat quality in Japanese quails. Comp Clin Pathol, 23, essential oil on performance, some blood parameters and ileal microflora 1503-1508, 2014. DOI: 10.1007/s00580-013-1813-6 of Japanese quail. Jpn Poult Sci Assoc, 49, 106-110, 2012. DOI: 10.2141/ 23. Grigore A, Paraschiv I, Colceru- Mihul S, Bubueanu C, Draghici jpsa.011089 E, Ichim M: Chemical composition and antioxidant activity of Thymus 5. Fritts CA, Waldroup PW: Evaluation of bio-mos mannanoligosaccharide vulgaris L. volatile oil obtained by two different methods. Romanian as a replacement for growth promoting antibiotics in diets for turkeys. Biotech Lett, 15 (4): 5436-5443, 2010. Int J Poult Sci, 2, 19-22, 2003. DOI: 10.3923/ijps.2003.19.22 24. Twetman S, Peterson LG: Effect of different chlorhexidine varnish 6. Ayed MH, Laamari Z, Rekik B: Effects of incorporating an antibiotic regimens on mutant streptococci levels in interdental plaque and saliva. avilamycin and a probiotic activis in broiler diets. Western Section ASAS. Caries Res, 31, 189-193, 1997. DOI: 10.1159/000262397 Am Soc Anim Sci, 55, 237-240, 2004. 25. Basilico MZ, Basilico JC: Inhibitory effects of some spice essential 7. Giannenas IA, Florou-paneri P, Botsoglou NA, Christaki E, Spais AB: oils on Aspergillus ochraceus NRRL 3174 growth and ochratoxinA Effect of supplementing feed with oregano and/or α-tocopheryl acetate production. Lett Appl Microbiol, 29, 238-241, 1999. DOI: 10.1046/j.1365- on growth of broiler chickens and oxidative stability of meat. J Anim 2672.1999.00621.X Feed Sci, 14, 521-535, 2005. 26. Goni P, Lopez P, Sanchez C, Gomez-Lus R, Becerril R, Nerin C: 8. Florou-Paneri P, Giannenas I, Christaki E, Govaris A, Botsoglou N: Antimicrobial activity in the vapour phase of a combination of cinnamon Performance of chickens and oxidative stability of the produced meat as and clove essential oils. Food Chem, 116, 982-989, 2009. DOI: 10.1016/j. affected by feed supplementation with oregano, vitamin C, vitamin E and foodchem.2009.03.058 their combinations. Arch Geflugelkd, 70(5), 232-240, 2006. 27. Mikaili P, Mohammad Nezhady MA, Shayegh J, Asghari MH: Study 9. Christaki E, Florou-paneri P, Giannenas I, Papazahariadou M, of antinociceptive effect of Thymus vulgaris and Foeniculum vulgare Botsoglou NA, Spais AB: Effects of mixture of herbal extracts on broiler essential oil in mouse. Int J Acad Res, 2, 374-376, 2010. chickens, infected with Eimeria tenella. Anim Res, 53, 137-144, 2004. DOI: 28. Aksu T, Bozkurt AS: Effects of dietary essential oils and/or humic 10.1051/animres:2004006 acids on broiler performance, microbial population of intestinal content 10. Florou-Paneri P, Christaki E, Giannenas I, Papazahariadou M, and antibody titres in summer season. Kafkas Univ Vet Fak Derg, 15, 185- Botsoglou N.A, Spais AB: Effect of dietary olympus tea (Sideritis scardica) 190, 2009. DOI: 10.9775/kvfd.2008.89-A supplementation on performance of chickens challenged with Eimeria 29. Çiftçi M, Şimşek UG, Azman MA, Çerçi IH, Tonbak F: The effects tenella. J Anim Feed Sci, 13, 303-313, 2004. of dietary rosemary (Rosmarinus officinalis L.) oil supplementation on 11. Govaris A, Florou-Paneri P, Botsoglou E, Giannenas I, Amvrosiadis performance, carcass traits and some blood parameters of Japanese I, Botsoglou N: The inhibitory potential of feed supplementation with quail under heat stressed condition. Kafkas Univ Vet Fak Derg, 19, 595-599. rosemary and/or α-tocopheryl acetate on microbial growth and lipid 2013. DOI: 10.9775/kvfd.2012.8474 oxidation of turkey breast during refrigerated storage. LWT, 40, 331-337, 30. Küçükyılmaz K, Çatlı AU, Çınar M: Etlik piliç yemlerine esansiyel 2007. DOI: 10.1016/j.lwt.2005.10.006 yağ karışımı ilavesinin büyüme performansı, karkas randımanı ve bazı 12. Botsoglou E, Govaris A, Christaki E, Botsoglou N: Effects of dietary iç organ ağırlıkları üzerine etkileri. Kafkas Univ Vet Fak Derg, 18, 291-296, olive leaves and/or α-tocopheryl acetate supplementation on microbial 2012. DOI: 10.9775/kvfd.2011.5443 growth and lipid oxidation of turkey breast fillets during refrigerated 31. NRC: National Research Council, Nutrient requirements of poultry. 9th storage. Food Chem, 121, 17-22, 2010. DOI: 10.1016/j.foodchem.2009.11.083 rev. ed., National Academy Press, Washinghton, DC 1994, pp: 44-45. 13. Biricik H, Yesilbag D, Gezen SS, Bulbul T: Effects of dietary myrtle 32. AOAC: Offical Methods of Analysis, AOAC International, Arlington, VA; oil (Myrtus communis L.) supplementation on growth performance, meat 2006. oxidative stability, meat quality and erythrocyte paramaters in quails. Revue Med Vet, 163 (3): 134-138, 2012. 33. TSE: Hayvan yemleri, metabolik (çevrilebilir enerji) tayini (Kimyasal metot). TSE No: 9610, 1991. 14. Christaki E, Bonos EM, Florou-Paneri P: Comparative evaluation of dietary oregano, anise and olive leaves in laying Japanese guails. Rev 34. Luna LG: Manual of Histologic Staining Methods of Armed Forces th Bras Cienc Avic, 13, 97-101, 2011. DOI: S1516-635X2011000200003 Institute of Pathology. 3 ed., 222-226. Mc Graw-Hill Book Comp, New York, 1968. 15. Schuhmacher A, Reichling J, Schnitzler P: Virucidal effect of peppermint oil on the enveloped herpes simplex virus type 1 and type 2 in 35. Bozkurt M, Sandıkçı M: The variations in height and width of vitro. Phytomed, 10, 504-510, 2011. intestinal villi and goblet cell and mitotic cell counts in chicks of different 16. Dorman HJD, Kosar K, Holm Y, Hiltunen R: Antioxidant properties age groups. YYU Vet Fak Derg, 20, 5-9, 2009. and composition of aqueous extracts from Mentha species, hybrids, 36. Parlat SS, Yıldız AO, Cufadar Y, Olgun O: Effects of thyme essential varieties and cultivars. J Agric Food Chem, 51, 4563-4569, 2003. DOI: oil supplementation ın performance of Japanese quail exposed to 10.1021/jf034108k experimental aflatoxicosis. J Agr Faculty (Turkey), 19, 1-6, 2005. 17. Akbari M, Torki M: Effects of dietary chromium picolinate and 37. Denli M, Okan F, Uluocak AN: Effect of dietary supplementation peppermint essential oil on growth performance and blood biochemical of herb essential oils on the growth performance, carcass and intestinal parameters of broiler chicks reared under heat stress conditions. Int J characteristics of quail (Coturnix coturnix japonica). S Afr J Anim Sci, 34 (3): Biometeorol, 58, 1383-1391, 2014. DOI: 10.1007/s00484-013-0740-1 174-179, 2004. 18. Gülçin I, Oktay M, Kireçci E, Küfrecioğlu OI: Screening of antioxidant 38. Tucker L: Botanical broilers: Plant extracts enhance broiler performance. and antimicrobial activities of anise (Pimpinella anisum L.) seed extracts. Feed Int, 23 (9): 26-29, 2002. Food Chem, 83, 371-382, 2003. DOI: 10.1016/S0308-8146(03)00098-0 39. Celik R: The effects of supplementation different levels essential oil 19. Al-kassie GAM: The effect of anise and rosemary on broiler mixed (Mint+Thyme+Thrush+Rosemary) in drinking waters on growing performance. Int J Poult Sci, 7 (3): 243-245, 2008. performance, slaughter and carcass traits in broilers. Master Thesis, Kafkas 20. Tabanca N, Bedir E, Kirimer N, Baser K.H, Khan SI, Jacob MR, Khan Univ, Health Sci Enst, 2015. IA: Antimicrobial compounds from Pimpinella species growing in Turkey. 40. Ciftci M, Guler T, Dalkilic B, Ertas N: The effect of anise oil (Pimpinella Planta Med, 69, 933-938, 2003. DOI: 10.1055/s-2003-45103 Anisum L.) on broiler performance. Int J Poult Sci, 4 (11): 851-855, 2005. 21. Soliman KM, Badea RI: Effect of oil extracted from some medicinal 41. Simsek GU, Guler T, Cifci M, Ertas ON, Dalkilic B: Esansiyel yağ plants on different mycotoxigenic fungi. Food Chem Toxıcol, 40, 1669- karışımının (kekik, karanfil, anason) etlik piliçlerde canlı ağırlık, karkas ve 1675, 2002. DOI: 10.1016/S0278-6915(02)00120-5 etlerin duyusal özellikleri üzerine etkisi. YYU Vet Fak Derg, 16 (2): 1-5, 2005. 260 Effects of Different Levels ... 42. Hernandez F, Madrid J, Garcia V, Orengo J, Megias MD: Influence Feed Sci Technol, 194, 89-98, 2014.DOI: 10.1016/j.anifeedsci.2014.04.014 of two plant extracts on broilers performance digestibility and digestive 45. Sengun, T, Yurtseven S, Cetin M, Kocyigit A, Sogut B: Effect of organ size. Poult Sci, 83, 169-174, 2004. DOI: 10.1093/ps/83.2.169 thyme (T. vulgaris) extracts on fattening performance, some blood 43. Halle I, Thomann R, Bauermann U, Henning M, Kohler P: Effects parameters, oxidative stress and DNA damage in Japanese quails. J Anim of graded supplementation of herbs and essential oils in broiler feed on Feed Sci, 17, 608-620, 2008. growth and carcass traits. Landbauforsch Volk, 54, 219-229, 2004 46. Cabuk, M, Eratak S, Alçiçek A, Tuglu I: Effect of herbal essential oil 44. Ghazaghi M, Mehri M, Bagherzadeh-Kasmani F: Effects of dietary mixture on intestinal mucosal development, growth performance and mentha spicata on performance, blood metabolites, meat quality and weights of internal organs of quails. J Essent Oil Bear PL, 17, 599-606, 2014. microbial ecosystem of small intestine in growing Japanese quail. Anim DOI: 10.1080/0972060X.2014.935025 Kafkas Univ Vet Fak Derg KafKas Universitesi veteriner faKUltesi Dergisi 22 (2): 261-264, 2016 JoUrnal Home-Page: http://vetdergi.kafkas.edu.tr Research Article DOI: 10.9775/kvfd.2015.14391 online sUbmission: http://vetdergikafkas.org Determination of Iron Deficiency Anemia in Helicobacter Infected Dogs [1] Yücel MERAL 1 Duygu DALĞIN 1 Mehtap ÜNLÜ SÖĞÜT 2 [1] This study was supported by The Scientific Research Council of Ondokuz Mayis University in Samsun, Turkey (Project number PYO.VET.1904.09.003) 1 University of Ondokuz Mayis, Faculty of Veterinary, Department of Internal Medicine, TR-55139 Atakum, Samsun - TURKEY 2 University of Ondokuz Mayis, Health School, TR-55139 Atakum, Samsun - TURKEY Article Code: KVFD-2015-14391 Received: 15.09.2015 Accepted: 03.11.2015 Published Online: 03.11.2015 Abstract Many studies demonstrated that Helicobacter infections in humans affects iron metabolism and decreases ferritin level resulting with iron deficiency anemia. The aim of this study is the investigation of a correlation between Helicobacter infection and iron deficiency anemia in dogs. The material of the study consisted of 42 Helicobacter (+) (determined with polymerase chain reaction-PCR- following upper gastrointestinal system endoscopy) dogs (Group I) (n=42) referred with vomiting after feeding, anorexia and epigastric pain in the abdominal palpation, and 21 (Group II) (n=21) dogs negative for Helicobacter with PCR and in the routine clinical examinations. Grup I were given therapy against Helicobacter gastritis for 21 days. Blood specimen were obtained from Group I at 0. and 21. days and Group II at 0. day for blood count and ferritin levels. Iron deficiency anemia was observed in 28 dogs of 42 (66.6%) infected with Helicobacter. In conclusion, iron deficiency anemia can be a probable evidence in frequently diagnosed Helicobacter infections in dogs and must be considered in the diagnostic and therapeutic plan. This is also the first study investigating iron deficiency anemia in Helicobacter infections of dogs as far as our knowledge. Keywords: Helicobacter, Dog, Iron deficiency, Anemia, Serum ferritin Helikobakter Enfeksiyonlu Köpeklerde Demir Yetmezliği Anemisinin Belirlenmesi Özet Helikobakter enfeksiyonunun insanlarda demir metabolizmasını etkileyerek ferritin seviyesinin düşüşüne neden olduğu ve demir eksikliği anemisi oluşturduğu çeşitli çalışmalarla ortaya konulmuştur. Bu çalışmanın amacı, köpeklerde helikobakter enfeksiyonu ile demir eksikliği anemisi arasında bir ilişki olup olmadığının araştırılmasıdır. Çalışma materyalini, yemeyi takiben kusma, iştahsızlık ve abdominal palpasyonda epigastrik ağrı şikayeti ile getirilen ve üst gastro intestinal sistem endoskopisi sonucu polimeraz zincir reaksiyonu (PZR) ile helikobakter (+) olduğu saptanan 42 adet (Grup I) (n=42) köpek ve rutin klinik muayeneleri ve PZR’yle pozitiflik saptanmayan 21 adet (Grup II) (n=21) köpek oluşturmuştur. Grup I, Helikobakter gastritisi yönünden 21 gün süreyle tedavi edildi. Grup I’den 0. ve 21. günler, Grup II’den 0.gün kan sayımı ve serum ferritin bakıldı. Helikobakter ile enfekte 42 köpeğin 28’inde (%66.6) demir eksikliği anemisi saptandı. Sonuç olarak, köpeklerde sıklıkla gözlenen helikobakter enfeksiyonlarında demir eksikliği anemisinin kuvvetle muhtemel bir bulgu olabileceği ve hastanın teşhis ve tedavi şeması dahilinde göz önüne alınması gerekliliği ortaya konmuştur. Bu aynı zamanda, araştırmalarımız çerçevesinde köpeklerde Helikobakter enfeksiyonlarında demir eksikliği anemisini inceleyen ilk araştırmadır. Anahtar sözcükler: Helikobakter, Köpek, Demir yetmezliği, Anemi, Serum ferritin INTRODUCTION between H. pylori and gastric diseases in humans have been discovered [2,3]. The existence of spiral bacterium in the stomach At least 4 types of spiral organisms colonized in the of humans and animals has been recognized since the stomach of cats and dogs are known. These are H. felis [3], beginning of 1800s [1]. In addition to this, a relationship H. salomonis [4], H. bizzozeronii [5] and H. heilmannii [2] also  İletişim (Correspondence)  +90 555 5128917  ymeral@omu.edu.tr 262 Determination of Iron Deficiency ... named Gastropirillium hominis. Many studies has been instructions. The 100 µl of extracted DNA was kept frozen attempted for the detection of H. pylori in dogs, but only at -20°C until molecular tests were carried out. Genus- few reported positive results [6,7], so it is very rare. spesific PCR analysis was conducted as reported by Riley et al.[17], and the observation of a 375 bpm band was Recently, O’ Rourke et al.[8] have managed to distinguish considered as positive (Fig. 1). The DNA of Helicobacter H. felis, H. salomonis, H. bizzozeronii and H. heilmannii by pylori, found in culture collection of our faculties’ conducting sequence analysis of a part of urease gene microbiology department, was used as positive control complex. In subsequent studies, it has been found out that in all PCR analyses. H. pylori experimentally causes a similar disease in dogs [7], but Helicobacter is a frequent infection an dogs [9,10]. The dogs, diagnosed Helicobacter spp. positive with PCR were treated for 21 days as stated by Aytuğ [18]. On Although there are many studies [11-16] on helicobacter day 0 and 21, whole blood count and serum biochemistry infections and iron deficiency in human medicine, it has were conducted. The group in which positivity was not not been completely revealed with what mechanisms this detected with PCR (Group II) (n=21) was accepted healthy condition occurs in humans with helicobacter infections. after routine clinical examinations and whole blood count The explanation most commonly offered for this relation- and ferritin determinations performed on day 0. ship is based upon the development of H. pylori-associated chronic pangastritis with resultant achlorhydria and reduced While dogs in Group I (n=42) consisted of 22 crossbreeds, ascorbic acid secretion leading to reduced intestinal iron 2 labradors, 5 golden retrievers, 12 terriers, and 1 Turkish absorption. Other potential explanations for an association shepherd dog, Group II (n=21) consisted of 18 crossbreeds, between iron deficiency and H. pylori include occult blood 2 golden retrievers, and 1 German shepherd. There were loss from erosive gastritis and sequestration and utilization 28 male and 14 female dogs in Group I (17-32 kg) and 17 of iron by the organism [12]. In a retrospective study on female and 4 male dogs in Group II (15-25 kg). Average age of 1294 patients diagnosed with iron deficiency, Ünal et the animals were 3-7 years (5.4±1.5). al.[15], performed upper gastrointestinal endoscopy in 205 patients and found out that 84 of these patients (41%) Via jugularis, 2 ml of blood was obtained from dogs were helicobacter (+). In their study, Serin and Serin [14], into tubes with heparin and anticoagulant-free tubes. reported that Helicobacter infection should be definitely Blood samples with heparin were analysed in Abacus Vet considered in patients with treatment-resistance iron Junior device and the results of the blood count (RBC, HGB, deficiency anemia. Similarly, in the human literature, it HCT, MCV, MCH, MCHC, RDWc, PLT) were saved separately is often stated that helicobacter infections may cause for each animal. After anticoagulant-free blood samples growth failure in children; however, this situation has not were centrifuged 5.000 rpm/5 min, they were taken into been clearly put forward. As ferritin is also an acute phase eppendorf tubes with the help of serum micropipette protein, the chances of inflammatory diseases, such as liver extricated from blood. Serum was stored at -18°C for diseases and hemolytic diseases increase. In iron deficiency analysis. anemia, serum ferritin level decreases, and it increases In the serums obtained, ferritin was analysed with in chronic disease anemia. Although there are many ELISA [19,20]. Ferritin (FE) ELISA Kit (ABIN991700) was used studies [11,13,14] and discussions on it in human medicine, and evaluated according the manufacturers instructions. there are no authentic studies about it in veterinary medicine as far as our knowledge. Our study aims to reveal For the gastroscopic examination, dogs were not the relationship between helicobacter infections in dogs given any food for a day. H2 receptor blockers, antiacidic and iron deficiency anemia. treatment and antibiotic were not used for a week and in the last three hours intake of water was prevented. Dogs MATERIAL and METHODS were anaesthesized before the procedure. For gastroscopic examination, preparations were made in line with the Animal material consisted of 42 dogs (Group I) which gastroscopic examination procedure for clinically sick and were referred to Ondokuz Mayıs University, Faculty of healthy dogs. For gastric endoscopy, a flexible endoscopy Veterinary Medicine, Department of Internal Diseases device with Olympos® XQ20 model working channel and between 2013-2014, due to vomiting after being fed, cold light source was used. Following the examination of loss of appetite and epigastric pain in the abdominal front gastrointestinal channel, PCR liquid was taken from palpation. the stomach where was stored at -18°C for analysis. PCR analysis was conducted according to the method reported For the diagnosis of helicobacteriosis, gastro intestinal by Riley et al.[17] as described above. The assessment system endoscopy materials were analysed with PCR. DNA of the results have been done using one-way ANOVA extraction of contents were conducted with commercially and Duncan’s multiple range tests in statistical package available DNA extraction kits (PureLink Genomic DNA program (SPSS, 12.0). The findings have been presented Kits, Invitrogen, Canada) according to the manufacturers’ as average values and standard error. 263 MERAL, DALĞIN ÜNLÜ SÖĞÜT RESULTS and sequestration and utilization of iron by the organism. In their study, Serin and Serin [14], reported that helicobacter Iron deficiency anemia were diagnosed in 28 of 42 infection should definitely be considered in patients with (66.6%) dogs in Group 1. Blood count and ferritin levels of treatment-resistant iron deficiency. While Bakır [21], explain the Group 1 dogs with iron deficiency are demonstrated helicobacter infections causing iron deficiency anemia in in Table 1. As seen, results demonstrate microcytic-hypo- people with autoimmune gastritis, Michael [22], reports that chromic anemia, characteristic of iron deficieny and low hepcidin hormone, which is an inflammation mediator, ferritin levels in dogs with Helicobacter gastritis. Species- prevents iron from being taken into the cell by getting specific PCR results are presented in Fig. 1. on the protein that allows iron go in through the cell surface; Table 1. Blood count and serum ferritin parameters of Helicobacter infected dogs with iron deficiency anemia Tablo 1. Demir eksikliği anemisi gözlenen Helicobacter ile enfekte köpeklerin kan sayımı ve serum ferritin parametreleri Helicobacter Infected Dogs with Iron Deficiency, Group I (n=28) Parameter Group II (n=21) Day 0 Day 21 (Healthy Group) Range RBC (106µl) 5.08±1.70a 5.26±0.60a 6.11±1.20b 5.50-8.50 HGB (g/dl) 11.11±0.90a 12.07±1.40b 13.04±2.10b 12.00-18.00 HCT (%) 30.66±3.56a 31.12±2.70a 38.21±4.32b 37.00-55.00 MCV (fl) 58.27±3.30a 62.32±2.50b 62.41±5.20b 60-77 MCH (pg) 21±6.40a 23.82±40b 22.02±4.80a 22-24.50 MCHC (g/dl) 35.15±5.17a 37.39±4.20b 36.82±8.21b 36.00-38.00 PLT (103µl) 596±116a 289±141b 421±132.40c 200-500 Ferritin ng ml−1 27±61a 158±36b 171±44b 36-220 [6,16] Groups that are assigned a different letter have been found to be statistically significant at the level of P≤0.05 Fig 1. Species-specific PCR results . M: marker ; 1, 3, 4 and 8’th the examples are positive, the others negative Şekil 1. Tür spesifik PZR sonuçları. M: Markır; 1, 3, 4 ve 8. örnekler pozitif, diğerleri negatif DISCUSSION that the hunger for iron inside the cell causes iron stores to be emptied; that iron- which is abundant in circulation- Although helicobacter has been known for about is caught by macrophages and therefore iron deficiency 95 years, it was defined in real terms in the 20th century. anemia develops. In his study, on the other hand, Arrigo [9], Scientists have focused on the essential information reports that helicobacter gastritis reduces hydrochloric that belongs to the bacterium for the last 20 years [8,14,17]. acid and ascorbic acid secretion and therefore iron There are evidences on the fact that helicobacter infections malabsorption develops. cause iron deficiency [11-16]. The explanation most commonly offered for this relationship is based upon the development In veterinary medicine, a study regarding the relationship of H. pylori-associated chronic pangastritis with resultant between Helicobacter infections and iron deficiency achlorhydria and reduced ascorbic acid secretion leading anemia has not been reported yet as far as our literature to reduced intestinal iron absorption. Other potential search. Only Gazyagci and Macun [23] reported microcytic explanations for an association between iron deficiency anemia due to gastric ulcer in a dog in which ferritin level and H. pylori include occult blood loss from erosive gastritis was at the bottom of the reference spectrum and elevated 264 Determination of Iron Deficiency ... after the therapy, and this can be due to blood loss from R, Ghiara P, Taccini E: A conventional beagle dog model for acut and the gastric ulcer. chronic infection with Helicobacter pylori. Infect Immun, 67 (6): 3112-3120, 1999. Due to the positive correlation between serum ferritin 8. O’Rourke JL, Dixon MF, Jack A, Enno A, Lee A: Gastric B-cell mucosa- levels in animals and their body iron stores, ferritin gives associated Lymphoid tissue (MALT) lymphoma in an animal model of Helicobacter heilmannii infection. J Path, 203, 896-903, 2004. DOI: the most accurate information about the condition of 10.1002/path.1593 iron stores in the body [24]. In iron deficiency anemia, 9. Arrigo B: Helicobacter pylori-related ıron deficiency anemia: A review. serum ferritin level decreases, and it increases in chronic Helicobacter, 7, 71-75, 2002. DOI: 10.1046/j.1083-4389.2002.00073.x disease anemia [19,20,24], because as ferritin is also an acute 10. Meral Y, Gökalp G, Semirgin SU, Söğüt MÜ: Determination of phase protein, an increase is expected in inflammatory Helicobacter infections with 14C urea breath test (14C UBT) and polymerase diseases such as liver diseases and haemolytic an increase. chain reaction (PCR) in dogs and treatment. Kafkas Univ Vet Fak Derg, 21, As seen in Table 1, serum ferritin level decreased in dogs 327-332, 2015. DOI: 10.9775/kvfd.2014.12484 with helicobacter gastritis (27±61), similar to the reports 11. Neiger R, Simpson KW: Helicobacter infection in dogs and cats: Facts and fiction. J Vet Intern Med, 14 (2): 125-133, 2000. of human the literature [12,14,16]. Although dogs were not 12. Dubois S, Kearney D: Iron-deficiency anemia and Helicobacter pylori provided with any iron deficiency treatment, and only infection: A review of evidence. Am J Gastroenterol, 100, 453-459, 2005. received helicobacter gastritis treatment, in the measurement DOI: 10.1111/j.1572-0241.2005.30252.x of serum ferritin levels done on day 21, a statistical rise in 13. Hershko C, Ronson A, Souroujon M, Maschler I, Heyd J, Patz J: ferritin levels were observed (158±36) (Table. 1). In other Variable hematologic presentation of autoimmune gastritis: Age-related erythrocyte index parameters in Table 1, on the other progression from iron deficiency to cobalamin depletion. Blood, 107, hand, iron deficiency anemia symptoms (microcytic- 1673-1679, 2006. DOI: 10.1182/blood-2005-09-3534 hypochromic type anemia) were detected as defined [24,25]. 14. Serin M, Serin T: Tedaviye dirençli demir eksikliği anemisinde Helicobakter pylori enfeksiyonu: Olgu sunumu. Bakırköy Tıp Dergisi, 4 (1): It has been reported that normocytic-normochromic- 37-39, 2008. nonregenerative anemia appears in chronic disease 15. Ünal HÜ, Fidan C, Korkmaz M, Selçuk H: Demir eksikliği olan anemia [24,25]. hastalarda gastrointestinal sistem endoskopi bulguları. Akademik Gastroenterol Derg, 11 (3): 113-116, 2012. In conclusion, we had been determined a rate of 66.6% 16. Yuan W, Li Y, Yang K, Ma B, Guan Q, Wang D, Yang L: Iron deficiency iron deficiency anemia in helicobacter infected dogs, so anemia in Helicobacter pylori infection: Meta-analysis of randomized persistent iron deficiency anemia should definitely be controlled trials. Scand J Gastroenterol, 45 (6): 665-676, 2010. DOI: considered in the diagnostic and therapeutic plan. Also, this 10.3109/00365521003663670 is the first study demonstrating the relationship between 17. Riley LK, Franklin CL, Hook Jr RR, C Besch-Williford C: Identification of murine helicobacters by PCR and restriction enzyme analyses. J Clin iron deficiency anemia and Helicobacter infection in dogs. Microbiol, 34 (4): 942-946, 1996. REFERENCES 18. Aytuğ N: Sindirim sistemi. In, Köpek ve Kedilerin İç Hastalıkları Klinik El Kitabı. 1-26, Medipres, Bursa, 2011. 1. Kidd M, Modlin IM: A century of Helicobacter pylori. Digestion, 59, 1-15, 19. Kiyotaka W, Naoko M, Yoshiko M, Kouichi O, Shozo O, Shinji 1998. DOI: 10.1159/000007461 Y: Biochemical properties of canine serum ferritin: Iron content and 2. Marshall B, Armstrong J, McGechie D, Ross JG: Attemp to fullfill nonbinding to concanavalin. BioMetals, 13, 319-324, 2000. Koch’s postulates for pyloric Campylobacter. Med J Aust, 142, 436-439, 20. Gordon AA, Patricia SC, Lisa MM, Lawrence D, David JSA: Enzyme- 1985. linked ımmunosorbent assay to quantitate serum ferritin in the Northern 3. Lee A, Hazell SL, O’Rourke J: Isolation of a spiral-shaped bacterium Fur Seal (Callorhinus ursinus). Zoo Biology, 23, 79-84, 2004. DOI: 10.1002/ from the cat stomach. Infect Immun, 56 (11): 2843-2850, 1988. zoo.10125 4. Jalava K, Kaartinen M, Utriainen M, Happonen I, Hanninen ML: 21. Bakır T: Autoimmune gastritis. Turkiye Klinikleri, J Gastroenterohepatol- Helicobacter salomonis sp. nov., a canine gastric Helicobacter related to Special Topics, 3 (3): 1-15, 2010. Helicobacter felis and Helicobacter bizzozeronii. Int J Sys Bacteriol, 47 (4): 22. Michael MF: Nonregenerative anemia: Recent advances in under- 975-982, 1997. standing mechanism of disease. Proc. ACVP/ASVCP Concurrent Annual 5. Hanninen ML, Happonen I, Saarı S, Jalava K: Culture and Meetings, Dec. 3-7, Nashville, Tennessee, USA. 2011. characteristics of Helicobacter bizzozeronii, a new canine gastric 23. Gazyağci S, Macun HC: Microcytic anemia due to gastric ulcer in a dog. Helicobacter spp. Int J Syst Bacteriol, 46 (1): 160-166, 1996. J Anim Vet Adv, 10, 365-366, 2011. DOI: 10.3923/javaa.2011.365.366 6. Buczolits S, Hirt R, Busse HJ: PCR-based genetic evidence for 24. Kaneko JJ, Harvey JW, Bruss ML: Iron metabolism and its disorder. occurance of Helicobacter pylori and novel Helicobacter species in In, Clinical Biochemistry of Domestic Animals. 6th ed., 259-285, Academic the canine gastric mucosa. Veterinary Microbiology, 95, 259-270, 2003. Press, San Diego, California, USA, 2008. DOI: 10.1016/S0378-1135(03)00182-2 25. Michael MF, Cludia AK: Reticulocyte indices in a canine model 7. Rossi G, Rossi M, Vitali CG, Fortuna D, Burroni D, Pancotto L, of nutritional iron deficiency. Vet Clin Pathol, 35, 172-181, 2006. DOI: Capecchi S, Sozzi S, Renzoni G, Braca G, Guidice GD, Rappuoli 10.1111/j.1939-165X.2006.tb00110.x Kafkas Univ Vet Fak Derg KafKas Universitesi veteriner faKUltesi Dergisi 22 (2): 265-271, 2016 JoUrnal Home-Page: http://vetdergi.kafkas.edu.tr Research Article DOI: 10.9775/kvfd.2015.14414 online sUbmission: http://vetdergikafkas.org Dimetilsülfoksit İlavesi ile Farklı Şekillerde Dondurulmuş Rumen Sıvısının in Vitro Sindirim Denemelerinde Kullanım Olanaklarının Araştırılması [1] Nihat DENEK 1 Abdullah CAN 2 Mehmet AVCI 1 [1] Bu çalışma TÜBİTAK tarafından desteklenmiştir (Proje No:TOVAG-109O445) 1 Harran Üniversitesi, Veteriner Fakültesi, Hayvan Besleme ve Beslenme Hastalıkları Anabilim Dalı, TR-63100 Şanlıurfa - TÜRKİYE 2 Harran Üniversitesi, Ziraat Fakültesi, Zootekni Bölümü, TR-63100 Şanlıurfa - TÜRKİYE Article Code: KVFD-2015-14414 Received: 18.09.2015 Accepted: 14.12.2015 Published Online: 13.01.2016 Özet Bu çalışmada, rumen sıvısı kaynağı olarak; taze rumen sıvısı, sıvı azot içerisinde dimetilsülfoksit (DMSO) katkısız ve katkılı (%5), derin dondurucuda DMSO katkısız ve katkılı (%5) dondurulmuş rumen sıvısı kullanılmıştır. Çalışmada 4 farklı kaba yem (mısır silajı, yonca kuru otu, mercimek samanı, buğday samanı), 4 farklı karma yem (sığır besi yemi, sığır süt yemi, toklu besi yemi ve buzağı büyütme yemi) ve 4 farklı yem hammaddesi (arpa, mısır, pamuk tohumu küspesi, soya küspesi) yem materyali olarak kullanılmıştır. İki aşamalı sindirim yönteminde deneme yemleri genel olarak değerlendirildiğinde gerek sıvı azot içerisinde ve gerekse derin dondurucuda dondurulan rumen sıvılarından elde edilen in vitro organik madde sindirim (İVOMS) değerleri taze rumen sıvısından elde edilmiş değerlerden düşük (P<0.05) bulunmuştur. Gaz üretim yönteminde ise yemlerin tamamı için %5 DMSO katkısı ile sıvı azot içerisinde dondurulmuş rumen sıvısından elde edilen İVOMS değerleri taze rumen sıvısından elde edilen değerler ile benzer (P>0.05) bulunmuştur. Araştırmada değerlendirilen tüm dondurulmuş rumen sıvılarındaki toplam anaerob bakteri ve toplam protozoa sayılarının, taze rumen sıvısındaki toplam anaerob bakteri ve protozoa sayılarına kıyasla azaldığı (P<0.05) görülmüştür. Protozoa türleri incelendiğinde %5 DMSO ilave edilerek sıvı azot içerisinde dondurulmuş rumen sıvısındaki canlı protozoa sayılarının kontrol grubu ile genel olarak benzer (P>0.05) olduğu belirlenmiştir. Bu araştırmadan elde edilen sonuçlara göre, %5 DMSO katkısı ile sıvı azot tankı içerisinde dondurulmuş rumen sıvılarının in vitro gaz üretim tekniğinde kullanılabileceği sonucuna varılmıştır. Anahtar sözcükler: Rumen sıvısı, in vitro sindirim, Dondurma, Sıvı azot, Derin dondurucu, Dimetilsülfoksit, DMSO An Investigation on Usage of Frozen Rumen Fluid with Adding Dimethylsulfoxide and Different Freezing Methods for Determination of in Vitro Digestibility Abstract In this study, fresh rumen fluid, liquid nitrogen frozen rumen fluids with addition of 5% dimethylsulfoxide (DMSO) or without DMSO, deep freeze frozen rumen fluid addition of 5% DMSO or without DMSO were investigated as inoculum sources. Four roughages (corn silage, alfalfa hay, lentil straw, wheat straw), four commercial feeds (beef finishing, dairy cattle, ram lamb finishing, calf growing feeds) and four feed ingredients (barley, corn, cotton seed meal, soybean meal) were chosen as feed materials. Values of in vitro organic matter digestibility (IVOMD) of feeds using fresh rumen fluid were found generally higher than the values obtained from nitrogen or deep freeze frozen inoculum sources (P<0.05) in two stage in vitro procedure. Values of IVOMD via gas production technique were similar (P>0.05) with using liquid nitrogen frozen rumen fluids with addition of 5% DMSO. Number of the anaerobic bacteria and total protozoa were diminished with both freezing methods comparison with fresh rumen fluid (P<0.05). Species of protozoa count of fresh rumen fluid and nitrogen frozen with 5% DMSO were found generally similar (P>0.05). According to result of this study liquid nitrogen frozen rumen fluid with addition of 5% DMSO can be suggest as an alternative inoculum source for the in vitro gas production technique. Keywords: Rumen fluid, in vitro digestion, Freezing, Liquid nitrogen, Deep Freeze, dimethylsulfoxide, DMSO  İletişim (Correspondence)  +90 414 3183892  nihatdenek@hotmail.com 266 Dimetilsülfoksit İlavesi ile ... GİRİŞ günden daha uzun süre dondurulma işleminde gaz üretim miktarının olumsuz yönde etkilendiğini bildirmişlerdir. Yapılan diğer bir çalışmada [11]Ruminant beslemede kullanılan yem maddelerinin gaz üretim tekniğinde 0°C’ enerji ve sindirim değerlerinin belirlenmesi genellikle in de 3, 6 ve 24 saat bekletilen ile -18°C’de 24 saat süre ile vivo yöntemlerle yapılmaktadır. Ancak in vivo yöntemlerin dondurulmuş rumen sıvıları kullanılmıştır. Kontrol grubu uygulanması zaman alıcı ve pahalı olması, araştırıcıları in ile 0°C’de 3 ve 6 saat bekletilen rumen sıvılarından elde vitro yöntemlere yöneltmiştir [1]. Yem maddelerinin in vitro edilen sonuçlar benzer bulunurken, -18°C’de 24 saat süre sindirim değerlerinin belirlenmesinde mikrobiyal fermen- ile dondurulmuş rumen sıvısından elde edilen değerler tasyon için taze rumen sıvısına ihtiyaç duyulmaktadır [2,3]. düşük bulunmuştur. Bu farklılık donma aşamasında intra- Yem analizleri yapan araştırma ve kurum laboratuarlarında sellüler buz kristallerinin oluşumuna ve buna bağlı olarak oluşan hücre harabiyeti ile açıklanmıştır. Prates ve ark.[12] rumen kanülü takılmış canlı hayvan barındırılma güçlüğü bu laboratuarlarda in vitro denemelerin yapılmasını engel- farklı şekillerde dondurulan rumen sıvısının gaz üretim lemektedir. İn vitro sindirim yöntemlerinin uygulanmasında, tekniğinde kullanılabilirliğini araştırmak amacıyla yaptıkları taze rumen sıvısı temini için cerrahi operasyonla hayvanlara bir çalışmada, gliserol katılarak sıvı azot içerisinde dondu- rumen kanülü takılması, olası sağlık problemlerinin ortaya rulan rumen sıvısından en yüksek gaz üretimi sağlanmıştır. çıkması, uzun süreli bakım masrafları ve bu hayvanların Bunun aksine -20°C’de derin dondurucuda ve gliserol kullanımı ile ilgili etik ve hayvan refahı gibi faktörlerin katılmaksızın sıvı azot içerisinde dondurulmuş rumen bulunması bu konuda çalışanlar için dezavantaj olarak sıvılarından ise en düşük gaz üretim değerleri elde edilmiştir. [4] [13]kabul edilmektedir . Bu faktörleri göz önünde bulunduran Abdel-Aziz ve ark. rumen protozolarının sıvı azot içerisinde araştırmacılar taze rumen sıvısına alternatif inokulant dondurulmalarına ilişkin yaptıkları bir çalışmada kriyo- kaynakları (dışkı ve enzim) üzerine araştırmalar yapmışlar protektan olarak %4, 5 ve 6 düzeyinde gliserol, DMSO ve ancak elde edilen sonuçların güvenli olmadığı sonucuna etilen glikol kullanmışlardır. Dondurulma süresi sonunda varmışlardır [5,6]. Rumen mikroorganizmalarının canlılıklarını çözdürülen protozoaların canlılıkları incelendiğinde, %5 sürdürebilmeleri için özel şartlara (oksijensiz ortam, 39°C DMSO ilavesinin en iyi sonuç verdiği bildirilmiştir. Benzer [14] ısı, nem vb.) ihtiyaç duyarlar. Rumen mikroorganizmaları şekilde Nsabimana ve ark. rumen protozoalarının dondu- için zorunlu olan bu ortam şartları rumen sıvısının kriyo- rulmasında kriyoprotektan olarak %4, 5 ve 6 düzeyinde protektan ilave edilmeksizin dondurularak saklanmasında DMSO kullanmışlar, %5 DMSO katkısının protozoaların bazı olumsuzluklar oluşturmaktadır. Rumen sıvısının dondu- canlılıklarının korunmasında en etkili seviyenin olduğunu rulmasında çeşitli kriyoprotektan maddeler (gliserol, dimetil bildirmişlerdir. Bu çalışma, sıvı azot ve derin dondurucuda sülfoksit, propilen glikol, etilen glikol, sukroz ve trehalose) dimetil sülfoksit (DMSO) ilave edilerek dondurulmuş rumen kullanılmaktadır. Bunlardan gliserol ve dimetil sülfoksit sıvılarının, taze rumen sıvısına alternatif olarak iki aşamalı (DMSO) en yaygın kullanım alanı bulmuştur. Kriyoprotek- in vitro sindirim ve gaz üretim tekniğinde kullanılabilirliğini tanlar genel olarak donma işlemi sırasında ya hücre içindeki araştırmak amacıyla yapılmıştır. sıvıyı hücre dışına almakta veya hücre içindeki sıvıyı çok küçük partiküller şeklinde dondurarak donma esnasında MATERYAL ve METOT intrasellular sıvının buz kristali oluşturmasını engelleyerek hücre harabiyetini en aza indirgemektedirler [7,8]. Kriyo- Araştırmada rumen sıvısı alınacak 3 baş ivesi toklusuna, protektanların bu özellikleri dondurulma ve çözme işlemi cerrahi operasyonla rumen kanülü takılması, bakım ve sonrasında rumen sıvısında bulunan çeşitli mikroorganizma- beslenmeleri ve hayvanlardan deneme süresince rumen ların aktivitelerinin devam etme olasılığını arttırmaktadır. sıvısı alınması Harran Üniversitesi Hayvan Deneyleri Yerel Etik Kurulu (HRÜ-HADYEK)’nun 2009/6 sayılı kurul kararı Gerek yemlerin iki aşamalı in vitro kuru madde doğrultusunda gerçekleştirilmiştir. Araştırmada yem materyali sindirilebilirliklerinin belirlenmesinde ve gerekse gaz üretim olarak ruminant beslenmesinde yaygın olarak kullanılan tekniğinin uygulanmasında dondurulmuş rumen sıvısı yem hammaddeleri kullanılmıştır. Bu amaçla 4 farklı kaba kullanılarak yapılmış sınırlı sayıda çalışma bulunmaktadır. yem (mısır silajı, yonca kuru otu, mercimek samanı, buğday Zeigler ve ark.[9] iki aşamalı in vitro kuru madde sindirim samanı), 4 farklı karma yem (sığır besi yemi, sığır süt yemi, denemesinde inokulant kaynağı olarak taze rumen sıvısı toklu besi yemi ve buzağı büyütme yemi) ve 4 farklı yem ve derin dondurucuda %5 gliserol ilave edilerek dondu- hammaddesi (arpa, mısır, pamuk tohumu küspesi, soya rulmuş rumen sıvısı kullanmışlardır. Araştırıcıların elde küspesi) kullanılmıştır. Yem maddeleri 1 mm elekten geçecek ettikleri sonuçlara göre derin dondurucuda katkısız olarak şekilde değirmende öğütüldükten sonra kuru madde (KM), dondurulan rumen sıvısı ile taze rumen sıvısından elde ham kül (HK), ham yağ (HY), ham protein (HP) ve ham edilen İVKMS değeri benzer bulunmuş, %5 gliserol katkısı selüloz (HS) analizleri Weende analiz sistemine göre [15], asit dondurulan rumen sıvısından elde edilen İVKMS değeri deterjan fiber (ADF) ve nötral deterjan fiber (NDF) analizleri ise taze rumen sıvısından elde edilen değerden düşük Van Soest ve Robertson’a [16] göre yapılmıştır. bulunmuştur. Cone ve ark.[10] tarafından in vitro gaz üretim denemesinde taze rumen sıvısını -24°C’de 1, 3, 10, 40 ve Araştırmada in vitro sindirim denemeleri iki aşamalı 76 gün boyunca dondurarak yaptıkları bir çalışmada, 10 sindirim denemesi ve gaz üretim tekniği olarak iki deneme 267 DENEK, CAN AVCI halinde yürütülmüştür. İki aşamalı in vitro organik madde dondurucuda yatay bir şekilde –21°C’de 1 ay süre ile sindirim değerlerinin belirlenmesinde Tilley ve Terry’nin [17] dondurularak saklanmışlardır. Eş zamanlı olarak sıvı azot bildirdiği, in vitro gaz üretim tekniği Menke ve Steingass’ içerisinde dondurulacak tüpler ise özel olarak hazırlanmış ın [18] bildirdiği yönteme göre uygulanmıştır. İn vitro bir düzenek üzerinde yatay bir şekilde hareket ettirilerek sindirim denemeleri her bir yem maddesi için 5’er tekerrür önce sıvı azot buharı ile ön donmaya maruz bırakıldıktan olacak şekilde uygulanmıştır. Araştırmada kullanılan rumen sonra tüpler sıvı azot stok tankı içerisine atılarak donma sıvısı, günde iki öğün halinde sabah 09:00 ve akşam 17:00 işlemi -196°C’de sabitlenmiştir. Sıvı azot içerisinde dondu- saatlerinde yaşama payının %25 fazlası düzeyinde %40 rulan tüpler in vitro sindirim denemelerinin uygulanacağı kesif (toklu besi yemi) ve %60 kaba yem (yonca kuru otu) zamana kadar (1 ay) sıvı azot tankı içerisinde saklanmıştır. ile beslenen rumen kanülü takılmış 60 kg (±3 kg) canlı DMSO katkılı ve katkısız olarak sıvı azot tankı ve derin ağırlığında, bir yaşlı 3 baş İvesi erkek tokludan temin dondurucuda bir ay süre ile dondurulan tüpler in vitro edilmiştir. Deneme hayvanlarının yeme alıştırma dönemi sindirim denemelerinin yapılacağı zamanda 39°C’deki su (20 gün) sonrasında sabah yemlemesinden 1 saat önce CO2 banyosu içerisinde 30-45 saniye içerisinde çözdürülerek gazı altında alınan rumen sıvısı içerisinde CO2 gazı ve sıcak kullanılmışlardır. Taze, DMSO katkılı ve katkısız sıvı azot su ile ısıtılmış cam şişede toplanarak, termos içerisinde içerisinde ve derin dondurucuda dondurulmuş rumen vakit kaybedilmeden laboratuara getirilmiştir. Laboratuara sıvılarındaki aktif rumen sıvısı bakterilerinin sayımı Dehority’ getirilen rumen sıvısı CO2 gazı altında 4 kat tülbent bezinden nin [19] belirttiği metoda göre yapılmıştır. Taze, sıvı azot süzülerek kontrol ve araştırma grupları için hazırlanan içerisinde ve derin dondurucuda DMSO ilave edilen ve falkon tüplerine konulmuştur. Kontrol (taze rumen sıvısı) edilmeyen dondurulmuş rumen sıvılarındaki toplam grubunda iki aşamalı in vitro sindirim yöntemi Tilley ve protozoaların sayımı Boyne ve ark.’nın [20] bildirdikleri Terry’nin [17], gaz üretim tekniği ise Menke ve Steingass’ yönteme göre, protozoa tiplerinin identifikasyonu ise ın [18] bildirdiği yönteme göre hemen başlatılmıştır. Deneme Boyne ve ark.[20] ile Ogimoto ve Imai [21] tarafından bildirilen grupları sıvı azot içerisinde dimetil sülfoksit (DMSO) katkısız yöntemlere göre yapılmıştır. ve katkılı (%5), derin dondurucuda DMSO katkısız ve katkılı (%5) dondurulmuş rumen sıvısından oluşturulmuştur. Bu Elde edilen veriler tesadüf parselleri deneme desenine amaçla; araştırma gruplarındaki tüplere (%5 DMSO katılan göre analiz edilmiştir. Deneme sonunda elde edilen veriler ve katılmayan) rumen sıvısı konarak tüplerin üzerinden deneme modeline uygun olarak varyans analizine tabii CO gazı geçirilmiş ve bu tüpler ağızları kapalı olarak tutulmuş, ortalamaların karşılaştırılmasında Duncan çoklu 2 [22] içerisinde 39°C ısıda su ve buz bulunan küvetler içerisinde karşılaştırma testi kullanılmıştır . İstatistiksel analizler [23] buzdolabında +4°C’de 30 dak. bekletilmiştir (equilibration SAS paket programı kullanılarak yapılmıştır. süresi). Buzdolabında bekletme süresi içerisinde DMSO katılan tüplere %5 oranında DMSO 10’ar dakikalık ara ile BULGULAR üç aşamada otomatik pipet yardımı ile ilave edilmiş ve sonrasında içerisinde rumen sıvısı bulunan tüpler CO2 gazı Araştırmada kullanılan yem maddelerinin ham besin ile doyurulmuştur. DMSO katılmayan tüpler ise sadece madde içerikleri Tablo 1’de sunulmuştur. Çalışmada değer- CO2 gazı ile doyurulma işlemi uygulanmıştır. Equilibration lendirilen yemlerin iki aşamalı in vitro sindirim yöntemi süresi sonunda DMSO katılan ve katılmayan tüpler derin ile İVOMS değerlerinin belirlenmesinde dondurulma Tablo 1. Araştırmada kullanılan yem maddelerinin ham besin madde içerikleri (g/kg, KM) Table 1. The chemical composition of the experimental feeds (g/kg, DM) Yemler DM HK HY HP ADF NDF HS Mısır silajı 932 63 36 71 288 532 240 Yonca kuru otu 914 87 21 139 390 529 263 Mercimek samanı 899 111 27 95 316 476 215 Buğday samanı 930 111 25 43 459 753 353 Sığır besi yemi 882 85 28 141 81 239 49 Sığır süt yemi 884 59 28 170 88 212 48 Toklu besi yemi 879 69 32 139 101 310 62 Buzağı büyütme yemi 892 94 37 175 111 299 72 Arpa 900 26 23 104 72 381 52 Mısır 873 13 30 81 45 163 21 Pamuk tohumu küspesi 898 60 10 283 291 447 164 Soya küspesi 871 65 10 476 76 130 36 KM: Kuru madde; HK: Ham kül; HY: Ham yağ; HP: Ham protein; ADF: Asit deterjan fibre; NDF: Nötr deterjan fibre; HS: Ham seluloz 268 Dimetilsülfoksit İlavesi ile ... yöntemi ile dimetil sülfoksit (DMSO) seviyesinin etkisi muştur. Araştırmada değerlendirilen yemlerin in vitro gaz Tablo 2’de sunulmuştur. Deneme yemleri genel olarak üretim tekniği ile İVOMS değerlerinin belirlenmesinde ele alındığında gerek sıvı azot içersinde ve gerekse derin dondurulma yöntemi ile dimetil sülfoksit (DMSO) seviyesi- dondurucuda dondurulan rumen sıvılarından elde edilen nin etkisi Tablo 3’te sunulmuştur. Deneme yemleri genel iki aşamalı İVOMS değerleri kontrol grubundan düşük olarak değerlendirildiğinde %5 DMSO ilavesi ile sıvı azot (P<0.05) bulunmuştur. Sıvı azot içerisinde DMSO katkısız içerisinde dondurulmuş rumen sıvısının inokulant olarak olarak dondurulmuş rumen sıvısı kullanılarak elde edilen kullanıldığı in vitro gaz üretim tekniğinde elde edilen İVOMS iki aşamalı İVOMS değerleri incelendiğinde bazı yemlerin değerleri tüm yemler için kontrol değerleri ile benzer (mısır silajı, buzağı büyütme yemi, arpa ve soya küspesi) (P>0.05) bulunmuştur. Araştırmada kullanılan kontrol ve haricinde elde edilen tüm yemler için bulunan İVOMS dondurulmuş rumen sıvılarına ait toplam anaerob bakteri değerleri kontrol değerlerinden düşük (P<0.05) bulun- ve protozoa sayılarına ilişkin elde edilen veriler Tablo 4’te Tablo 2. Yemlerin iki aşamalı in vitro metot ile organik madde sindirilebilirliklerinin belirlenmesinde dondurulma yöntemi ile dimetil sülfoksit (DMSO) seviyesinin etkisi Table 2. The effects of freezing method and dimethyl sulfoxide (DMSO) level on in vitro organic matter digestibility (IVOMD, %) of feedstuffs via two stage method Sıvı Azot Derin Dondurucu Yemler Kontrol SEM 0% DMSO 5% DMSO 0% DMSO 5% DMSO Mısır silajı 72.58a 69.6ab 68.59b 59.36c 54.66d 1.44 Yonca kuru otu 69.04a 66.03b 67.00b 60.03c 60.66c 0.75 Mercimek samanı 75.90a 71.16b 71.41b 66.12c 66.10c 0.78 Buğday samanı 58.73a 55.19b 51.26c 36.71e 39.32d 1.79 Sığır besi yemi 91.96a 89.78b 90.21b 85.75c 84.92c 0.58 Sığır süt yemi 91.74a 88.17b 89.00b 84.64c 83.85c 0.64 Toklu besi yemi 90.32a 88.0 b 87.07bc 83.35d 85.58c 0.50 Buzağı büyütme yemi 88.59a 86.90ab 85.69b 82.00c 81.57c 0.61 Arpa 90.84a 88.23a 87.41a 81.47b 79.96b 0.94 Mısır 95.33a 91.72b 90.30b 84.40c 86.41c 0.83 Pamuk tohumu küspesi 70.17a 65.12b 63.72b 61.93bc 59.03c 0.82 Soya küspesi 95.51a 94.74ab 94.04b 94.65ab 94.69ab 0.16 DMSO: Dimetilsülfoksit; SEM: Standart hata ortalaması, a-d Aynı satırda farklı harf taşıyan ortalama değerler arasındaki farklılık önemlidir (P<0.05) Tablo 3. Yemlerin in vitro gaz üretim tekniği ile organik madde sindirilebilirliklerinin belirlenmesinde dondurulma yöntemi ile dimetil sülfoksit (DMSO) seviyesinin etkisi Table 3. The effects of freezing method and dimethyl sulfoxide (DMSO) level on in vitro organic matter digestibility (IVOMD, %) of feedstuffs via gas production technique Sıvı Azot Derin Dondurucu Yemler Kontrol SEM 0% DMSO 5% DMSO 0% DMSO 5% DMSO Mısır silajı 61.24a 58.45a 59.86a 40.87c 48.01b 1.68 Yonca kuru otu 60.06 a 51.76b 57.95a 39.67d 44.26c 1.63 Mercimek samanı 61.07 a 56.67a 57.30a 40.66b 43.49b 1.77 Buğday samanı 40.64 a 37.02b 41.75a 27.03c 27.26c 1.33 Sığır besi yemi 73.61 a 73.96a 71.63a 62.80b 64.44b 1.05 Sığır süt yemi 71.44 a 72.73a 70.31ab 63.45c 66.04bc 0.82 Toklu besi yemi 68.56ab 68.69ab 70.90a 67.34b 65.75b 0.45 Buzağı büyütme yemi 66.62a 63.89a 65.30a 54.37b 54.54b 1.13 Arpa 76.11a 75.35a 74.42a 72.25b 67.50c 0.66 Mısır 77.71a 74.45b 78.91a 68.21c 65.88c 1.09 Pamuk tohumu küspesi 52.82a 45.82b 50.71a 37.65c 36.28c 1.38 Soya küspesi 77.11a 72.57b 77.12a 56.92c 56.47c 1.93 DMSO: Dimetilsülfoksit; SEM: Standart hata ortalaması; a-d Aynı satırda farklı harf taşıyan ortalama değerler arasındaki farklılık önemlidir (P<0.05) 269 DENEK, CAN AVCI Table 4. Toplam canlı anaerob bakteri ve protozoa sayıları (cfu/ml) üzerine dondurulma yöntemi ile dimetil sülfoksit (DMSO) seviyesinin etkisi Table 4. The effects of freezing method and dimethyl sulfoxide (DMSO) level on the number of total bacteria and protozoa (cfu/ml) Sıvı Azot Derin Dondurucu Bakteri ve Protozoa Sayıları Kontrol SEM 0% DMSO 5% DMSO 0% DMSO 5% DMSO TABS 104.0x108a 13.2x108bc 21.6x108b 6.4x108c 16.8x108bc 7.46 TPS 380.9x103a 121.3x103b 130.7x103b 128.9x103b 136.4x103b 20.76 Entodinium spp. 91.6x103a 66.8x103b 91.2x103a 60.4x103c 65.4x103b 2.77 Epidinium spp. 31.6x103a 29.8x103a 30.4x103a 8.4x103b 8.80b 2.22 Polipastron 4.0x103a 2.2x103b 2.8x103b 0.00c 0.00c 0.34 İsotrichia spp. 2.0x103a 1.0x103ab 0.8x103ab 0.00b 0.00b 0.21 Dastrichia spp. 1.2x103a 0.2x103b 0.6x103ab 0.00b 0.00b 0.13 TABS: Toplam Anaerob bakteri sayısı; TPS: Toplam protozoa sayısı; DMSO: Dimetilsülfoksit; SEM: Standart hata ortalaması; a-c Aynı satırda farklı harf taşıyan ortalama değerler arasındaki farklılık önemlidir (P<0.05) sunulmuştur. Toplam anaerob bakteri ve toplam protozoa İVOMS değerlerinin belirlenmesinde +18°C’de 48 saat sayıları tüm dondurulmuş rumen sıvılarında kontrol dene- muhafaza edilen rumen sıvısının kullanılabileceğini ancak mesinden düşük (P<0.05) bulunmuştur. Ancak gerek sıvı iki aşamalı in vitro sindirim metodunun mikrobiyal sindirim azot içerisinde ve gerekse derin dondurucuda uygulanan aşamasındaki 48 saatlik sürenin yetersiz olduğunu bildir- dondurma işleminde %5 DMSO ilavesinin rakamsal olarak mişlerdir. Bazı çalışmalarda [24-26], araştırmacılar kaba yemler toplam anaerob bakteri ve protozoa sayısını arttırdığı için iki aşamalı in vitro sindirim metodunun mikrobiyal görülmüştür. Protozoa türleri incelendiğinde Polipastron sindirim aşamasındaki 48 saatlik sürenin 72 saate çıkarıl- türü haricinde, sıvı azot içerisinde %5 DMSO katkısı ile masının gerektiğini bildirilmektedir. Benzer şekilde Denek dondurulmuş rumen sıvısındaki protozoa türlerinin kontrol ve ark.[27] bazı yem maddelerinin in vitro kuru madde grubu ile genel olarak benzer (P>0.05) olduğu görülmüştür. sindirim değerlerinin iki aşamalı yöntem ile belirlenmesinde derin dondurucuda %5 DMSO ilave edilerek dondurulmuş TARTIŞMA ve SONUÇ rumen sıvısı kullanmışlardır. Araştırıcılar [27] kaba yemler için 48 saatlik mikrobiyal sindirim aşamasının yeterli Bu çalışmada iki aşamalı in vitro yöntem ile elde edilen olmadığını, bu sürenin 72 saate çıkarıldığında iki aşamalı İVOMS değerleri incelendiğinde gerek sıvı azot içerisinde ve sindirim yönteminde elde edilen sonuçların taze rumen gerekse derin dondurucuda dondurulan rumen sıvılarından sıvısından elde edilen sonuçlar ile benzer bulunduğu elde edilen İVOMS değerlerinin kontrol grubundan düşük bildirmektedirler. Bu bildirimler doğrultusunda iki aşamalı (P<0.05) olduğu gözlenmiştir. Bazı yemlerin (mısır silajı, in vitro sindirim yöntemi ile yemlerin İVOMS değerlerinin buzağı büyütme yemi, arpa ve soya küspesi) sıvı azot belirlenmesinde mikrobiyal inokulant kaynağı olarak sıvı içerisinde DMSO ilave edilmeden dondurulmuş rumen azotta dondurulmuş rumen sıvısının kullanılabileceği, sıvısından elde edilen İVOMS değerlerinin kontrol değer- ancak 48 saatlik mikrobiyal inkubasyon arttırılmasına ilişkin leri ile benzer (P>0.05) olduğu, ancak bu benzerliğin yeni çalışmaların yapılmasına ihtiyaç duyulmaktadır. yemlerin genelini kapsamadığı gözlenmiştir. Zeigler ve Bu çalışmada, gaz üretim tekniği ile elde edilen İVOMS ark.’nın [9] yapmış oldukları çalışmada yemlerin in vitro kuru değerleri incelendiğinde, sıvı azot içerisinde %5 DMSO madde sindirim değerlerinin belirlenmesinde kriyoprotektan ilavesi ile dondurulmuş rumen sıvısından elde edilen ilave edilmeksizin dondurulmuş rumen sıvısının kullanıla- İVOMS değerlerinin tamamı kontrol değerleri ile benzer bileceği, %5 gliserol ilave edilerek dondurulan rumen (P>0.05) bulunmuştur. Ancak sıvı azot içerisinde DMSO sıvılarından elde edilen sonuçların ise taze rumen sıvısından ilave edilmeden dondurulmuş rumen sıvılarında ise bazı elde edilen değerlerden düşük sonuç verdiğini bildirmek- yemlerin (yonca kuru otu, mısır, pamuk tohumu küspesi tedirler. Araştırmacılar konsantre yemler için katkısız ve ve soya küspesi) İVOMS değerlerinin kontrolden düşük %5 gliserol katkılı dondurulmuş rumen sıvısından elde (P<0.05) olduğu görülmüştür. Derin dondurucuda gerek ettikleri in vitro sindirim değerlerinin taze rumen sıvısı %5 DMSO ilave edilmiş ve gerekse DMSO ilave edilmemiş ile benzer olduğunu, ancak yüksek seluloz içeriğine sahip gruplardan elde edilen İVOMS değerleri kontrol değerle- kaba yemlerde in vitro sindirim değerinin düşük olduğunu, rinden düşük (P<0.05) bulunmuştur. Prates ve ark.[12] in bu farklılığın ise dondurulma ve çözme işlemi sürecinde vitro gaz üretim tekniğinin uygulanmasında sıvı azotta rumen sıvısında bulunan selülotik bakterilerin zarar görmüş dondurulmuş rumen sıvısının taze rumen sıvısına alternatif olabileceği varsayımına bağlamaktadırlar [9]. Jones ve ark.’ olabileceğini, Rumen mikroorganizmalarının etkinliği bakı- nın [24] yaptıkları bir çalışmada taze rumen sıvısının +18°C’de mından sıvı azotta dondurmanın derin dondurucuda 48 saat boyunca etkinliğini yitirmeden saklanabileceğini dondurmadan daha etkin olduğunu bildirmektedirler. Bu bildirmektedirler. Araştırıcılar [24] kaba yemlerin iki aşamalı çalışmanın sonuçları incelendiğinde elde edilen sonuç- 270 Dimetilsülfoksit İlavesi ile ... ların Prates ve ark.’nın [12] sonuçları ile benzer olduğu inokulant kaynağı olarak sıvı azot içerisinde %5 DMSO görülmektedir. Hervas ve ark.’nın [11] yapmış oldukları bir katılarak dondurulmuş rumen sıvısının kullanılabileceği çalışmada, kriyoprotektan ilave edilmeden 0°C’de 3, 6 ve sonucuna varılmıştır. Bu sonuçlara göre belirli merkezlerde 24 saat ile derin dondurucuda veya -18°C’de 24 saat süre rumen kanülü takılmış hayvanlardan elde edilecek rumen ile dondurulmuş rumen sıvısını gaz üretim tekniğinde, sıvısına %5 düzeyinde DMSO ilave edilerek sıvı azot 0°C’de 3 ve 6 saat bekletilen rumen sıvılarından elde içerisinde dondurulması ile rumen kanülü açılmış donor edilen gaz üretim değerlerinin kontrol grubu ile benzer hayvan barındırma imkânı bulunmayan araştırma merkez- bulunurken, -18°C’de 24 saat süre ile dondurulan rumen lerinin bu inokulantları kullanarak in vitro sindirim dene- sıvısından elde edilen gaz üretim değerleri ise düşük melerini gerçekleştirmeleri mümkün görünmektedir. bulunmuştur. Araştırıcılar bu farklılığın sebebini donma aşamasında rumen mikroorganizmalarında intrasellüler Teşekkür buz kristallerinin oluşumuna ve buna bağlı olarak hücre harabiyetine bağlamaktadırlar. Bu çalışmada benzer olarak Bu araştırma TÜBİTAK tarafından desteklenmiştir (Proje DMSO katkılı ve katkısız olarak derin dondurucuda bir ay No.TOVAG-109O445). Desteklerinden dolayı TÜBİTAK’a ve süre ile dondurulmuş rumen sıvılarından elde edilen İVOMS çalışma kapsamında protozoa ve mikroorganizma sayımında değerleri kontrol değerlerinden düşük bulunmuştur. desteklerini esirgemeyen Prof. Dr. Hüdai İPEK ve Doç. Dr. Osman Yaşar TEL’e teşekkür ederiz. Araştırmada kullanılan taze ve dondurulmuş rumen sıvılarına ait toplam anaerob bakteri sayılarına ilişkin elde KAYNAKLAR edilen veriler incelendiğinde, toplam canlı anaerob bakteri sayıları gerek sıvı azot ve gerekse derin dondurucuda DMSO 1. Canbolat Ö: Bazı buğdaygil kaba yemlerinin in vitro gaz üretimi, etkisine bakılmaksızın azaldığı (P<0.05) tespit edilmiştir. sindirilebilir organik madde, nispi yem değeri ve metabolik enerji içeriklerinin karşılaştırılması. Kafkas Univ Vet Fak Derg, 18, 571-577, 2012. Ancak %5 DMSO katkısının her iki dondurma işleminde de DOI: 10.9775/kvfd.2011.5833 anaerob canlı bakteri sayısında rakamsal olarak artışa yol 2. Menke KH, Raab L, Salewski A, Steingass H, Fritz D, Schneider W: açtığı görülmektedir. Stewart ve ark.[28] rumen ortamında The estimation of the digestibility and metabolizable energy content of gram negatif bakterilerin çoğunlukta olduğunu ve bu ruminant feedstuffs from the gas production when they are incubated bakterilerin dondurma ve çözme işlemlerinden olumsuz with rumen liquor in vitro. J Agric Sci Camb, 93, 217-222, 1979. DOI: 10.1017/S0021859600086305 şekilde etkilendiklerini bildirmektedirler. Rumen sıvısının 3. Williams BA: Cumulative gas-production techniques for forage 0°C ve -30°C ısılarda dondurulması ile kötü sonuçlar elde evaluation. In, Givens DI, Owen E, Axford RFE, Omed HM (Eds): Forage edilirken, sıvı azot içerisinde (-196°C) yapılan dondurma Evaluation in Ruminant Nutrition. 189-213, CAB International, Wallingford, işleminde ise mikroorganizmaların uygulanan dondurma UK, 2000. işleminden fazla etkilenmediği bildirilmektedir [29,30]. Protozoa 4. Mauricio RM, Mould FL, Dhanoa MS, Owen E, Channa KS, Theodorou değerleri incelendiğinde sıvı azot içerisinde %5 DMSO MK: A semi-automated in vitro gas production technique for ruminant feedstuff evaluation. Anim Feed Sci Technol, 79, 321-330, 1999. DOI: ilavesi ile dondurulmuş rumen sıvısındaki canlı protozoa 10.1016/S0377-8401(99)00033-4 sayılarının kontrol grubu ile genel olarak benzer (P>0.05) 5. Mould FL: Predicting feed quality-chemical analysis and in vitro olduğu belirlenmiştir. Bu benzerlik Entodinium spp., evaluation. Field Crops Res, 84, 31-44, 2003. DOI: 10.1016/S0378- Epidinium spp., İsotrichia spp. ve Dastrichia spp. Türlerinde 4290(03)00139-4 tespit edilirken, Polipastron türünde tespit edilememiştir. 6. Mauricio RM, Owen E, Mould FL, Givens I, Theodorou MK, France Bazı çalışmalarda [31,32] rumen protozolarının %5 DMSO J, Davies DR, Dhanoa MS: Comparison of bovine rumen liquor and ilavesi ile dondurulması ve sonrasında çözüldüğünde bovine faeces as inoculum for an in vitro gas production technique for evaluating forages. Anim Feed Sci Technol, 89, 33-48, 2001. DOI: 10.1016/ canlılıklarının yüksek düzeyde olduğu belirtilmektedir. S0377-8401(00)00234-0 Yine Abdel-Aziz ve ark.’nın [13] rumen protozolarının sıvı azot 7. Mazur P: Freezing of living cells: Mechanisms and implications. Am içerisinde dondurulmalarına ilişkin yaptıkları bir çalışmada J Physiol, 247, 125-142, 1984. kriyoprotektan olarak %4, 5 ve 6 düzeyinde gliserol, DMSO 8. Tanasawa I: Things we do not know about cryopreservation of ve etilen glikol kullanmışlardır. Çözdürülen protozoaların biological organs. Ann N Y Acad Sci, 858, 227-234, 1998. DOI: 10.1111/ canlılıkları incelendiğinde %5 DMSO ilavesinin en iyi j.1749-6632.1998.tb10156.x sonuç verdiği görülmüştür. Benzer şekilde Nsabimana 9. Zeigler LD, Schlegel ML, Edwards MS: Development of a rumen fluid reservatıon technique and application to an in vitro dry matter ve ark.[14] kriyoprotektan olarak %4, 5 ve 6 düzeyinde digestibility assay. AZA Nutrition Advisory Group, 69-74, 2003. DMSO kullanmışlar ve en etkili DMSO seviyesinin %5 10. Cone JW, Van Gelder AH, Bachman H: Influence of inoculum source, olduğunu bildirmişlerdir. Yapılan bazı çalışmalarda rumen dilution and storage of rumen fluid on gas production profiles. In, Gas mikroorganizmaları üzerine DMSO’nun diğer kriyo- Production: Fermentation Kinetics for Feed Evaluation and to Assess protektanlardan daha etkin koruma sağlamasını hücreye Microbial Activity. Proc. EAAP Satellite Symposium on Gas Production, [33,34] Wageningen, The Netherlands, 18-19 August 2000. BSAS, Edinburgh, UK, daha hızlı nüfuz etmesine ve donma işlemi sırasında pp.74-75, 2000. hücre içerisinde buz kristalleri oluşturmamasına bağla- 11. Hervas G, Frutos P, Giraldez FJ, Mora MJ, Fernandez B, Mantecon maktadırlar [34]. AR: Effect of preservation on fermentative activity of rumen fluid inoculum for in vitro gas production techniques. Anim Feed Sci Technol, Bu araştırmanın sonuçlarına göre, yemlerin in vitro gaz 123, 107-118, 2005. DOI: 10.1016/J.anifeedsci.2005.05.004 üretim tekniği ile İVOMS değerlerinin tespitinde mikrobiyal 12. Prates A, de Oliveira JA, Abecia L, Fondevila M: Effects of 271 DENEK, CAN AVCI preservation procedures of rumen inoculum on in vitro microbial 24. Jones RJ, Stoltz MA, Meyer JHF, Bechaz FM: The effect of rumen diversity and fermentation. Anim Feed Sci Technol, 155, 186-193, 2010. fluid storage time on digestive capacity with five forage/browse samples. DOI: 10.1016/J.anifeedsci.2009.12.005 Trop Grassl, 32, 270-272, 1998. 13. Abdel-Aziz HM, Hassan HY, Abd-El-Raof YM, Abou-Zeina HAA, 25. Can A, Hummel J, Mobashar M, Boeser U, Sudekum KH: Comparison Galbt SA: Trails for cryopreservation of rumen protozoa in sheep. Global of sheep ruminal fluid with sheep and horse faeces as inoculum for in Veterinaria, 1, 9-16, 2007. vitro gas production measurements. J Appl Anim Res, 35, 143-148, 2009. 14. Nsabimana E, Kisidayova S, Macheboeuf D, Newbold CJ, Jouany DOI: 10.1080/09712119.2009.9707004 JP: Two-step freezing procedure for cryopreservation of rumen ciliates, an 26. Omed HM, Lovett D, Axford RFE: Faeces as a source of microbial effective tool for creation of a frozen rumen protozoa bank. Appl Environ enzymes for estimating digestibility. In, Givens DI, Owen E, Axford RFE, Microbiol, 69, 3826-3832, 2003. DOI: 10.1128/AEM.69.7.3826-3832.2003 Omed HM (Eds): Forage Evaluation in Ruminant Nutrition. 135-154, CAB 15. AOAC: Official Methods of Analysis of the Association of Official International, Wallingford, 2000. Analytical Chemists, 16th ed. (5th revision). AOAC International, Gaithersburg, 27. Denek N, Can A, Avci M: Frozen rumen fluid as a source of microbial MD, USA, 1999. inoculum for the two-stage in vitro digestibility assay of some ruminant 16. Van Soest PJ, Robertson JB, Lewis BA: Methods for dietary fiber, feeds. S Afr J Anim Sci, 40, 251-256, 2010. neutral detergent fiber, and nonstarch polysaccharides in relation to 28. Stewart CS, Flint HJ, Bryant MP: The rumen bacteria. In, Hobson PN, animal nutrition. J Dairy Sci, 74, 3583-3591, 1991. DOI: 10.3168/JDS. Stewart CS (Eds): The rumen Microbial Ecosystem. 2nd ed., 1072, Blackie S0022-0302(91)78551-2 Academic & Professional, London, UK, 1997. 17. Tilley JMA, Terry RA: A two-stage technique for in vitro digestion 29. Malik KA: Cryopreservation of bacteria with special reference to of forage. J Br Grassl Soc, 18, 104-111, 1963. DOI: 10.1111/J.1365- anaerobes. World J Microbiol Biotechnol, 7, 629-632, 1991. DOI: 10.1007/ 2494.1963.tb00335.x BF00452850 18. Menke KH, Steingass H: Estimation of the energetic feed value 30. Perry SF: Freeze-drying and cryopreservation of bacteria. Mol obtained from chemical analysis and in vitro gas production using rumen Biotechnol, 9, 59-64, 1998. fluid. Anim Res Devel, Separate Print, 28, 7-55, 1988. 31. Kisidayova S, Varadyova Z, Michalowski T, Newbold CJ: Regeneration 19. Dehority BA: Pectin-fermenting bacteria isolated from the bovine of cryoresistance of in vitro rumen ciliate cultures. Cryobiology, 51, 76- rumen. J Bacteriology, 99, 189-196, 1969. 84, 2005. DOI: 10.1016/j.cryobiol.2005.05.001 20. Boyne AW, Eadie JM, Raitt K: The development and testing of a 32. Kisidayova S, Michalowski T, Varadyova Z: Preliminary results of method of counting rumen ciliate protozoa. J Gen Microbiol, 7, 414-423, the regeneration of the in vitro rumen ciliate cultures - Effect of their 1957. DOI: 10.1099/00221287-17-2-414 cytoresistance. Endocytobiosis Cell Res, 17, 146-149, 2006. 21. Ogimoto K, Imai S: Atlas of Rumen Microbiology. Japan Sci Soc, 33. Hubalek Z: Protectants used in the cryopreservation of microorganisms. Press, Tokyo, pp. 158-231, 1981. Cryobiology, 46, 205-229, 2003. DOI: 10.1016/S0011-2240(03)00046-4 22. Snedecor GW, Cochran WG: Statistical methods. 6th ed., The Iowa 34. De la Fuente G, Cebria´n JA, Fondevila M: A cryopreservation State Univ. Press. Ames, 1980. procedure for the rumen protozoon Entodinium caudatum: estimation of 23. SAS Institute: SAS User’s Guide: Statistics, 5th ed., SAS Inc., Cary, NC, its viability by fluorescence microscopy. Lett Appl Microbiol, 38, 164-168, USA, 1989. 2004. DOI: 10.1111/j.1472-765X.2003.01464.x Kafkas Univ Vet Fak Derg KafKas Universitesi veteriner faKUltesi Dergisi 22 (2): 273-279, 2016 JoUrnal Home-Page: http://vetdergi.kafkas.edu.tr Research Article DOI: 10.9775/kvfd.2015.14429 online sUbmission: http://vetdergikafkas.org Evaluation of Serum and Ascitic Fluid Proteomes in Dogs with Dilated Cardiomyopathy [1] Meriç KOCATÜRK 1 Ahmet Tarık BAYKAL 2 Şeyma TÜRKSEVEN 2 Çiğdem ACIOĞLU 2 Carlos Fernando AGUDELO 3 Zeki YILMAZ 1 [1] This study was partly supported by The Scientific and Technological Research Council of Turkey (TOVAG-111O026) 1 Uludag University, Veterinary Teaching Hospital, Internal Medicine Department, TR16059Gorukle, Bursa - TURKEY 2 TUBITAK Marmara Research Center, Genetic Engineering and Biotechnology Institute, TR-41400 Kocaeli - TURKEY 3 Small Animal Cardiology, Clinic for Diseases of Dogs and Cats, Faculty of Veterinary Medicine, University of Veterinary and Pharmaceutical Sciences, Brno, Palackého tř. 1/3, 612 42 Brno, CZECH REPUBLIC Article Code: KVFD-2015-14429 Received: 23.09.2015 Accepted: 06.11.2015 Published Online: 13.11.2015 Abstract The aim of the study was to investigate serum global proteomes in dogs with overt dilated cardiomyopathy (DCM) and to evaluate protein expression in serum with that in ascitic fluid. Eight healthy dogs (control group) and 8 dogs with DCM were included in the study. DCM was diagnosed based on echocardiographic evidence including increased left ventricular dimension at diastole and systole, increased E point to septal separation, and decreased fractional shortening. Serum and ascitic fluid samples were analyzed for proteomes using a label-free LC-MS/MS method. Proteome analyses revealed significantly different expressions of eight proteins in all samples. Expressions in serum of apolipoprotein (Apo) A1, Ig heavy chain V, superoxide dismutase and plasminogen were higher (P<0.001), while expressions of clusterin, hemoglobin subunit ß, Apo-CII, and β2 glycoprotein I (ß2GPI) were lower (P<0.001) in dogs with DCM than in control dogs. In addition, Apo-A1, clusterin, hemoglobin subunit ß, Ig heavy chain V, plasminogen and ß2GPI were down-regulated whereas Apo-CII and superoxide dismutase were up-regulated in ascitic fluid compared with serum in dogs with DCM. Data obtained in the present study suggest that serum and/or ascitic fluid proteomes may explain some of the pathophysiological mechanisms involved in the progression of DCM. Keywords: Dilated cardiomyopathy, DCM, Congestive heart failure, Proteomics, Dog Dilate Kardiyomiyopatili Köpeklerde Serum ve Asites Sıvısı Proteomlarının Araştırılması Özet Çalışmamızın amacı ileri düzeyde dilate kardiyomiyopati (DCM) tanısı konulan köpeklerde serum global proteomların araştırılması ve aynı hastaların asites sıvısı proteomları ile ilişkilerinin değerlendirilmesidir. Sekiz sağlıklı (kontrol grubu) ve 8 DCM’li köpek çalışmaya dahil edildi. DCM tanımlaması ekokardiografik olarak sistol ve diyastolde artmış sol ventriküler çap, artmış E point to septal separasyon değeri ve azalmış fraksiyonel kasılma verileri temelinde yapıldı. Serum ve asites sıvı örnekleri label-free LC-MS/MS metoduna göre analiz edilmiştir. Proteom analizi ile tüm örneklerde toplam sekiz adet proteom ekspresyonu belirlendi. DCM’li köpeklerde kontrol grubuna göre serum apolipoprotein (Apo) A1, Ig heavy chain V, superoksit dizmutaz ve plazminojen ekspresyonlarında artış (P<0.001), klasterin, hemoglobin subunit ß, Apo-CII, ve β2 glikoprotein I (ß2GPI) ekspresyonlarında ise azalma (p<0.001) belirlendi. Buna ek olarak; asites sıvısı serum örnekleri ile karşılaştırıldığında Apo-A1, klasterin, hemoglobin subunit ß, Ig heavy chain V, plazminojen ve ß2GPI azalırken, Apo-CII ve superoksit dizmutaz artış gösterdi. Çalışmada elde edilen bu verilerin; serum ve/veya asites sıvısı proteomlarının DCM gelişiminde rolü alan bazı patofizyolojik mekanizmaların açıklanmasına katkı verebileceği kanısındayız. Anahtar sözcükler: Dilate kardiyomiyopati, DCM, Konjestif kalp yetmezliği, Proteomik, Köpek INTRODUCTION or thin wall and septal thickness, depressed systolic thickening of the free wall and septum, poor fractional Dilated cardiomyopathy (DCM) sis one of the most shortening (FS), large E point to septal separation (EPSS), common organic heart defects in dogs [1]. Echocardiographic reduced aortic wall motion and global hypokinesis [1,2]. features include ventricular dilation, atrial dilation, normal Ventricular dilation including generally the left side of the  İletişim (Correspondence)  +90 224 2940817  merick@uludag.edu.tr 274 Evaluation of Serum and Ascitic ... heart and poor myocardial function are the main findings and echocardiographic examinations were performed. of DCM [2]. Such abnormalities of the heart muscle result Two-dimensional (2D) echocardiography, M-mode, color in chemical and organic reactions cause biomarker release flow imaging and spectral Doppler examinations were such as natriuretic peptides and cardiac troponins [3]. Many performed using a CarisPlus® (Esoate, Florence, Italy) researchers have focused on specific biomarker indicating with a 2.5-5 MHz phased-array transducer using standard myocardial injury in DCM [3]; however, new trend of the techniques [2]. The dogs were not sedated throughout science is interested in such small peptides, rather than the the ultrasound examination, and were gently restrained whole proteins, called proteomics [6]. in right lateral recumbency. DCM was diagnosed based on the echocardiographic findings such as increased Proteomics is the large-scale study of protein chamber size, increased EPSS and poor FS along with expression, protein-protein interactions, or post-translational ECG and thoracic radiographic findings. Diagnosis was modifications [6-8]. Use of proteomics technology in confirmed using a scoring system for DCM proposed by veterinary medicine is presently under development. European Society for Veterinary Cardiology [2]. Patients Samples and study designs are discussed due to the presented with all of the criteria for DCM but did not limitations of mass spectrometry [9]. In veterinary medicine have any other cardiac pathology including congenital proteomics were performed in such conditions as canine malformations or tumors. Dogs with primary congenital lymphoma [10] and heartworm disease [11] while canine heart disease, mitral valve disease or endocrine disorders DCM has not yet been studied using proteomics. In such as hypothyroidism were excluded. addition, although proteomics were performed in several canine body fluids such as cerebrospinal fluid [12], urine [13], Radiologic Evaluation bronchoalveolar lavage fluid [14] and follicular fluid [15], no data have yet been presented on ascitic fluid in dogs with Assessment of cardiomegaly on thoracic radiography DCM. In the present study, we hypothesized that many was based on a combination of subjective experience and of the serum proteomes with low abundance and low the use of the vertebral heart scale system [16]. molecular weight may have roles in the development of DCM in dogs. Besides, proteomic analyses of ascitic Sample Collection and LC-MS/MS Analysis fluid may provide further details to explain some patho- Serum and ascitic fluid samples were obtained from physiologic mechanism and/or some clinical complications patients before the treatment. Samples were kept in -80ºC such as abdominal distention and pleural effusion in freezer until being sent in cold chain to the laboratory dogs with DCM. for analyses [TUBITAK, Genetical Engineering and Bio- Therefore, we aimed to analyze expressional proteomics technology Institute (GEBI), Gebze, Kocaeli, Turkey]. in both serum and ascitic fluid samples, using label-free Protein expression analyses in serum and ascetic fluid LC-MS/MS method, in order to present novel data that may samples were performed using a label-free nano liquid help improve our understanding of the pathophysiology chromatography - mass spectrometry method. Extracted of canine DCM. proteins from the samples were reduced with dithriothreitol (DTT; 5 mM, 15 min) and alkylated with iodoacetic acid MATERIAL and METHODS (IAA; 10 mM, 30 min at dark). Tryptic peptides were generated by incubating the protein mixture at 37ºC with Animals sequencing grade trypsin (1:50 ratio, Pierce). The peptide mixture was loaded on a nanoACQUITY UPLC Symmetry Eight dogs with DCM (5 females, 3 males) with C18 Trap column (5 µm particle size, 180 µm i.d. x 20 mm different breed (Mixed breed n=4, Terrier n=2, Pointer n=1, length) at 5 μl/min flow rate for 5 min. Peptides were Anatolian Sheepdog n=1) and an average age of 54.8±30.8 eluted from the trap column by gradient elution onto an months (range: 10-96 months), and 8 clinically healthy analytical column (nanoACQUITY UPLC BEH C18 Column, dogs (4 females, 4 males) with different breed (Mixed 1.7 µm particle size, 75 µm i.d. x 250 mm length, Waters), at breed n=5, Terrier n=2, Anatolian sheepdog n=1) and an 300 nl/min flow rate with a linear gradient from 5 to 40% average age of 50.2±16.4 months (range: 2 to 8 years) were acetonitrile over 90 min. Data independent acquisition included in the study. All dogs with DCM were suffering mode (MSE) was carried out by operating the instrument from congestive heart failure (CHF) findings such as at positive ion V mode. Mass drift was corrected by the cough, lethargy, anorexia, dyspnea, exercise intolerance, internal mass calibrantglu-fibrinopeptide infused every abdominal distension and/or pleural effusion. 45 sec through the nanolockspray ion source at 300 nl/min Electrocardiographic and Echocardiographic flow rate. Peptide signal data between 50-1.600 m/z values Evaluations were collected. Data processing parameters were set to standard operating values [17]. The Apex3D parameters After routine clinical examination, electrocardiography were set to 0.2 min chromatographic peak width and (ECG, Esaote, P200®- Florence, Italy), thoracic radiography 10.000 TOF resolution. 150, 50 and 1.200 counts were set 275 KOCATÜRK, BAYKAL, TÜRKSEVEN ACIOĞLU, AGUDELO, YILMAZ for low energy, elevated energy and intensity threshold, Electrocardiographic (ECG) Findings respectively. Tandem mass spectra extraction, charge state deconvolution and deisotoping were processed with ECG analysis revealed some cardiac rhythms ab- ProteinLynx Global Server v2.3 software (PLGS) (Waters normalities in dogs with DCM in which atrial fibrillation Corp., Milford, MA). Protein sequence database from Uniprot (5/8) (Fig. 1), ventricular extra systoles (2/8), atrioventricular was used. Databank search query was set to minimum 3 block (1/8) and sinus tachycardia (2/8) were the most fragment ion matches per peptide, minimum 7 fragment common. ion matches per protein, minimum 1 peptide matches per protein and 1 missed cleavage. Carbamidomethyl-cysteine Radiological Findings fixed modification and Acetyl N-terminal, deamidation Enlarged heart size, deviation of the trachea, mild of asparagine and glutamine, oxidation of methionine to severe pulmonary edema, increased vertebral heart variable modifications were set. Normalization of the scale (14.2±1.3), pulmonary pattern, caudal vena cava proteins was achieved against the digest of the internal distension, and pleural and peritoneal effusions were calibrant P00330. observed on thoracic radiography in dogs with DCM (Fig. 2). Statistical Analyses Two-dimensional Echocardiographic Findings Data were analyzed by Student’s t test using SPSS All dogs with DCM had geometric and functional cardiac 10.0 Statistical Software (SPSS Inc), and the results were abnormalities. LA diameter (4.62±0.4 cm), LA/Ao ratio expressed as Mean ± Standard error of means (SEM). (2.08±0.4), left ventricular diastole diameter (6.3±0.7 cm) The intensity % coefficient of variation (%CV Int) were and EPSS value (1.1±0.3 cm) were above the reference calculated to be around 14% across the identified proteins limits. Poor FS (15.8±4.8%) was observed in dogs with so three times the %CV Int value is set for the cut-off for DCM, as well (Table 1, Fig. 3). Pulmonary artery flow velocity statistical significance. Only proteins expressional changes was higher (P<0.001) but aortic flow velocity was lower showing more than 40% up-regulation or down-regulation (P<0.001) than those of healthy controls (Table 1). were reported. For all comparisons, values of P<0.05 were considered significant. Serum and Ascitic Fluids Proteomics RESULTS Expressions of 8 proteins (Apolipoprotein[Apo]A1, hemoglobin subunit ß, clusterin, Ig heavy chain V region, Clinical Findings Apo-CII, plasminogen, b 2 glycoprotein I [ß2GPI] and superoxide dismutase) differed significantly in blood and Clinical charts of dogs with DCM included dyspnea ascitic fluid samples (Table 2). Apo-A1, Ig heavy chain V, (6/8), lethargy (4/8), exercise intolerance (8/8), and anorexia superoxide dismutase and plasminogen expressions in (5/8). Clinical examination revealed weak femoral artery serum samples were higher (P<0.05 - 0.01), while clusterin, pulse, distension of the jugular vein, abdominal distension, hemoglobin subunit ß, Apo-CII and β2GPI expressions were increased cardiac auscultation area and mitral and/or lower (P<0.05 - 0.001) in dogs with DCM than in healthy tricuspidal murmurs with different severities in all patients controls. Expressions of Apo-A1, clusterin, hemoglobin with DCM. subunit ß, Ig heavy chain V, plasminogen, and ß2GPI were Fig 1. ECG from a dog with DCM (7 year-old, male, Turkish Shepherd Dog) revealed an atrial fibrillation due to absence of “P waves” and increased heart frequency (Calibration: 50 mm/second, 10 mm/1 mV) Şekil 1. DCM’li bir köpek EKG’sinde (7 yaşlı, erkek, Kangal) ‘P dalgalarının’ olmaması ve artmış kalp frekası nedeniyle atriyal fibri- lasyon belirlenmiştir (Kalibrasyon: 50 mm/ saniye, 10 mm/1 mV) 276 Evaluation of Serum and Ascitic ... B Fig 2. Radiologic evaluation of the thorax in a 8-year-old male Turkish Shepherd Dog. A: The right lateral radiograph points out the general lung tissue opacity, dorsal deviation of the trachea and the vascular hilus, bronchiectasis of the cranial lobe bronchus and enlargement of the heart borders in the thoracic cavity, B: The ventrodorsal radiograph shows general opacity, alveolar model influence of the lung lobes and unclear hearth silhouette as well as left side shift of the hearth suspected due to cardiomegaly Şekil 2. 8 yaşlı erkek Kangal bir köpekte toraksın radyolojik olarak değerlendirilmesi. A: Sağ lateral radyografi genel akciğer dokusu opasitesindeki artışı, trakeanın dorsale deviyasyonu ve hilus vaskülarizasyonunu, kraniyal lob bronşunda bronşiyektaziyi ve torasik boşlukta kalbin sınırlarının genişlemiş olduğunu vurgulamaktadır, B: Ventrodorsal grafi genel opasite, akciğer loblarında alveoler etkilenim ve şüphelenilen kardiyomiyopati nedenli sol tarafa kaymaya ek olarak belirsiz kalp siluyeti belirtmektedir Fig 3. M-mode measurement of the left ventricle at right parasternal short axis view showed increased chamber size, poor fractional shortening and interventricular septal akinesia. Hyperechoic line in the pericardial sac indicated mild pericardial effusion (A). Left atrial dilation (left atrium/aorta ratio: 1.7) was observed on right parasternal short axis view - aortic level (B) Şekil 3. Sol ventrikülün sağ parasternal kısa eksen M-mod görüntüsü artmış odacık büyüklüğü, zayıf fraksiyonel kısalma ve interventriküler septal akinezi olduğunu göstermiştir. Perikardiyal kesedeki hiperekoik çizgi hafif bir parikasrdiyal efüzyonu işaret etmektedir (A). Sağ parasternal kısa eksen görüntü- ortik düzeyde sol atriyal genişleme (Sol atriyum /aorta oranı: 1.7) belirlenmiştir (B) down-regulated whereas expressions of  Apo-CII and ascitic fluid of dogs with DCM and made comparisons with superoxide dismutase were up-regulated in ascitic fluid regard to serum proteomes between dogs with DCM and compared with serum in dogs with DCM. healthy controls. Significant differences were detected in expressions of a total of 8 proteins (Apo-A1, hemoglobin DISCUSSION subunit ß, clusterin, Ig heavy chain V region, Apo-CII, plasminogen, ß2GPI and superoxide dismutase) in both The present study reported, for the first time, serum and ascitic fluid of dogs with DCM. In the study, evaluation of protein expression changes in blood and DCM was diagnosed based on the echocardiographic 277 KOCATÜRK, BAYKAL, TÜRKSEVEN ACIOĞLU, AGUDELO, YILMAZ Tablo 1. DCM’li ve sağlıklı köpeklerin ekokardiografik parametreleri reason for low serum clusterin level, since clusterin is also a (Mean ± SE) renal damage biomarker in dogs [19,20]. Increased vascular Table 1. Echocardiographic parameters of the dogs with DCM and healthy permeability due to serum protein escape from the blood dogs (Mean ± SE) stream and the venous return loss in response to heart Dogs with DCM Healthy dogs failure might be responsible of low clusterin levels in Parameter n=8 n=8 P value dogs with DCM studied. In the present study, the possible Body weight (Kg) 32.2 ±8.5 28.4±4.3 ns reason for decreased level of serum clusterin in dogs with DCM may be related with the result of excessive use of IVSD (cm) 1.1±0.5 0.82±0.06 <0.01 the protein in situations such as increased cell death and IVSs (cm) 2.53±1.17 1.63±0.41 ns oxidative stress status. LVDd (cm) 6.37 ±0.7 4.54±0.33 <0.001 Previous studies suggested that Apo-A1is responsible LVDs (cm) 5.4±0.7 3.20±0.25 <0.001 of cholesterol transport from tissues to the liver [11]. However PWd (cm) 0.88±0.37 0.94±0.11 <0.01 vena cava caudalis pressure overload as a result of decreased PWs (cm) 1.03±0.34 1.05±0.12 ns venous return to the heart may play a role on liver- Ao diameter (cm) 2.22 ±0.4 2.0±0.1 ns ischemia-induced loss of free cholesterol esterification. LA diameter (cm) 4.62±0.4 2.3±0.0 <0.001 In this pathophysiology, high blood cholesterol plays a role on erythrolysis and hemoglobin release [11]. The mild LA/Ao ratio 2.08±0.4 1.2±0.0 <0.001 increase in hemoglobin subunit ß protein detected in EPSS (cm) 1.1±0.3 0.3±0.1 <0.001 the present study might have resulted from increased FS % 15.8±4.8 30.20±2.41 <0.001 demand of O2 in the body in response to decreased PA Vmax m/s 0.6±0.09 0.33±0.03 <0.001 cardiac output (lower aortic flow velocity), the myocardial AoVmax m/s 0.7±0.14 1.3±0.1 <0.001 contractility loss (lower FS), and decreased venous return (Jugular distention and higher pulmonary artery flow BW: body weight; IVSD: interventricular septum diastole; IVSs: interventricular septum systole; LVDd: left ventricular diameter diastole; velocity) in dogs with DCM. An increased O2 demand may LVDs: left ventricular diameter systole; PWd: post wall diastole; PWs: be explained by superoxide anion radical formation in post wall systole; Ao: aorta; LA: left atrium; LA/Ao ratio: left atrium/ conjunction with increased superoxide dismutase, an anti- aorta ratio; EPSS: E-point to septal separation; FS: fractional shortening; oxidant protein. β2GPI molecule was classified as an Apo, PA: pulmonary artery; ns: not significant and it was initially termed Apo-H [21]. Among connected results, decreased level of serum Apo-H might be a result Table 2. List of the protein expression results and fold changes (+ increase; - of protection mechanism against oxidative stress induced decrease) between serum from dogs with DCM (DCM) and healthy controls by apoptotic ischemic cells. Consistent with this hypo- (H) or ascitic fluid (A) thesis, Apo-H was shown to be present in atherosclerotic Tablo 2. DCM’li (DCM) ve sağlıklı (H) köpeklerin serumları veya asites sıvıları (A) arasındaki protein salınım sonuçlarının ve son değerlerin başlangıç plaques [22] and involved in apoptosis process at surfaces değerlerine oranlarının listesi ( + artış; - azalış) of cells undergoing apoptosis [21,23]. Fold Change In our study, Apo-CII was low (354.8 fold change) in Accession # Description DCM vs H DCM vs A serum samples of dogs with DCM. This might be the result of increased permeability of veins and impaired circulation P02648 Apolipoprotein A 1 1.42 (+)** 1.41 (+)** ended with Apo-CII escape from circulation to ascites P25473 Clusterin 1.40 (-)* 1.21 (+)* fluid. Apo-CII was reported to be a cofactor for lipoprotein P60524 Hemoglobin subunit ß 1.40 (-)* 3.65 (+)** lipase and identified as a putative substrate of matrix P01784 Ig heavy chain V region GOM 1.41 (+)** 1.77 (+)** metalloproteinases (MMP-7, MMP-14) in humans, and a P12278 Apolipiprotein C II 354.8 (-)*** 299.7 (-)*** deficiency in Apo-CII was associated with atherosclerosis [24]. In good accordance, Kawano et al.[25] showed that a mutation P80009 Plasminogen Fragment 1.44 (+)** 1.36 (+)** in the Apo-II gene caused coronary atherosclerosis. Since P33703 ß 2 Glycoprotein 1 2.31 (-)** 47.6 (+)*** canine Apo-CII has not been studied yet, we can only O54210 Superoxide dismutase Mn 1.65 (+)* 1.66 (-)* speculate that it might be involved in pathogenesis of Fe fragment atherosclerosis as in humans. vs - versus, * P<0.05, ** P<0.01, s*** P<0.001 Venous return loss, impaired circulation and pleural findings along with ancillary diagnostic tests including and peritoneal effusion, as observed in the present study, ECG and thoracic radiography, as suggested [2]. are the signs of congestive heart failure (CHF) in dogs with DCM [1,2]. A previous study [26] reported high plasma Clusterin has a protective role on stress-mediated fibrinogen, D-dimer, thrombin-antithrombin complex and apoptosis, oxidative stress and protein aggregation low anti-thrombin activity in dogs with chronic CHF. We inhibition [18]. Cardiorenal syndrome may be another showed, in the present study, changes in expressions of 278 Evaluation of Serum and Ascitic ... proteins related with coagulation in dogs with DCM, based especially serum Apo-CII level may be accepted as a risk on serum proteomics data including increased expression factor for developing DCM in dogs. of plasminogen and decreased expression of β2GPI. It is well known that plasminogen has a fibrinolytic activity, Acknowledgements and β2GPI has procoagulant and anticoagulant activities in the coagulation cascade [27]. β2GPI can also bind to We thank Prof. Dr. Mehmet CANSEV (Dep. of plasminogen and lipoprotein A, a molecule conferring Pharmacology, Medical Faculty, Uludag University, Bursa, a putative risk for atherosclerotic disease in humans [21]. Turkey) for his comments and grammatical correction of It may thus be suggested that plasminogen and β2GPI the manuscript. act together to regulate intrinsic fibrinolytic pathways in dogs with DCM [21,27]. conflict of interest On the other hand, our study has several limitations. The None of the authors of this article has a financial or number of the dogs is not enough to represent the whole personal relationship with other people or organizations population, because this is a pilot study in which specific that could inappropriately influence or bias the content breed or sex variation was not investigated. In addition, of the paper. while our results seem like not related with breed type or sex, physiological states like ovulation may be involved in REFERENCES alterations in serum proteomics. These limitations warrant a larger-scale study. 1. Martin MW, Stafford Johnson MJ, Strehlau G, King JN: Canine dilated cardiomyopathy: A retrospective study of prognostic findings in 367 Since hematological or endocrinological changes clinical cases. J Small Anim Pract, 8, 428-436, 2010. DOI: 10.1111/j.1748- 5827.2010.00966.x would change the proteomic scale, serum proteome 2. Boon JA: Veterinary Echocardiography, 2nd ed., Wiley-Blackwell, USA, mapping of the dogs with DCM was challenging. Despite 2010. having controlled many variables, still some other 3. Oyama MA: Using cardiac biomarkers in veterinary practice. Vet mechanisms might have affected the analysis results. Clin North Am: Small Anim Pract, 43, 1261-1272, 2013. DOI: 10.1016/j. Serum proteomics can easily be affected by physiological cvsm.2013.07.010 conditions therefore proteins found in this study might 4. Çakıroğlu D, Meral Y, Bakırel U, Kazancı D: Cardiac Troponin Levels be altered by physiological variables [9]. In parallel with in Dogs with Dilate Cardiomyopathy. Kafkas Univ Vet Fak Derg, 15, 13- this explanation, human studies showed that patients 17, 2009. DOI: 10.9775/kvfd.2008.31-A show different proteomic patterns in pathophysiological 5. Güneş V, Uyanık F, Eren M, Kibar M, Aslan Ö, Onmaz AC: The rapid analyses of cardiac troponins in dogs with dilated cardiomyopathy, conditions such as sepsis [28] and diabetes mellitus [29]. distemper or parvovirus infection. Kafkas Univ Vet Fak Derg, 20, 921- 927, 2014. DOI: 10.9775/kvfd.2014.11403 There are some studies on structural proteomics of 6. Basaran E, Aras S, Cansaran-Duman D: Genomik, proteomik, the canine heart [30,31], and our study did not include brain metabolomik kavramlarına genel bakış ve uygulama alanları. Türk Hijyen natriuretic peptide or cardiac troponin I detection in both ve Deneysel Biyoloji Dergisi, 67 (2): 85-96, 2010. samples (serum and ascitic fluid). This might be associated 7. Bantscheff M, Schirle, M, Sweetman G, Rick J, Kuster B: Quantitative with potential loss of high molecular bounded target mass spectrometry in proteomics: A critical review. Anal Bioanal Chem, proteins in protein immune-affinity depletion step of the 389, 1017-1031, 2007. proteomic analysis technique or binding to the depletion 8. Kurban S, Mehmetoğlu İ: Proteomik. Yeni Tıp Dergisi, 27, 70-75, 2010. column [32-34]. Immune-affinity depletion is essential for 9. Lippolis JD, Reinhardt TA: Utility, limitations, and promise of proteomics in animal science. Vet Immunol Immunopathol, 138, 241-251, eliminating most abundant proteins such as albumin, but 2010. DOI: 10.1016/j.vetimm.2010.10.003 loss of target proteins in this step narrows the data and 10. Atherton MJ, Braceland M, Fontaine S, Waterston MM, Burchmore makes more questionable [9]. RJ, Eadie S, Eckersall PD, Morris JS: Changes in the serum proteome of canine lymphoma identified by electrophoresis and mass spectrometry. In conclusion, the study presented here that DCM in Vet J, 196, 320-324, 2013. DOI: 10.1016/j.tvjl.2012.12.010 dogs shows different peptide pattern in the blood stream, 11. Hormaeche ME, Carretón E, González-Miguel J, Gussoni S, Montoya- which are the result of increased O demand, hemostatic Alonso JA, Simón F, Morchón R: Proteomic analysis of the urine of 2 and fibrinolytic system changes and oxygen free radicals Dirophylaria immitis infected dogs. Vet Parasitol, 203, 241-246, 2014. DOI: 10.1016/j.vetpar.2014.01.025 and progressive organ damage, as well as the heart itself. 12. Martin-Vaquero P, da Costa RC, Allen MJ, Moore SA, Keirsey JK, In this study, observed proteomes in serum and ascitic fluid Green KB: Proteomic  analysis of  cerebrospinal fluid  in  canine  cervical samples enhances the search for informative biomarkers spondylomyelopathy. Spine, 40, 601-612, 2015. DOI: 10.1097/ in biological samples from healthy dogs or dogs with DCM, BRS.0000000000000831 thus allowing an earlier and more precise diagnosis and a 13. Brandt LE, Ehrhart EJ, Scherman H, Olver CS, Bohn AA, Prenni deeper comprehension of pathogenesis, development JE: Characterization of the  canine  urinary proteome. Vet Clin Pathol, 43, 193-205, 2014. DOI: 10.1111/vcp.12147 and outcome of cardiomyopathy. Proteomic analysis 14. Lenz AG,  Meyer B,  Weber H, Maier K: Two-dimensional electro- in dogs with DCM may be useful to evaluate dynamic phoresis of dog bronchoalveolar lavage fluid proteins. Electrophoresis, 11, pathophysiological changes of the disease process, and 510-513, 1990. DOI: 10.1002/elps.1150110616 279 KOCATÜRK, BAYKAL, TÜRKSEVEN ACIOĞLU, AGUDELO, YILMAZ 15. Fahiminiya S, Reynaud K, Labas V, Batard S, Chastant-Maillard S, 26. Tarnow  I,  Falk T,  Tidholm A, Martinussen T, Jensen AL, Olsen Gérard N: Steroid hormones content and proteomic analysis of canine LH, Pedersen HD, Kristensen AT: Hemostatic biomarkers in dogs with follicular fluid during the preovulatory period. Reprod Biol Endocrinol, 8, chronic congestive heart failure. J Vet Intern Med, 21, 451-457, 2007. 132, 2008. DOI: 10.1186/1477-7827-8-132 27. Bu C, Gao L, Xie W,Zhang J, He Y, Cai G, McCrae KR: Beta2- 16. Buchanan JW, Bücheler J: Vertebral scale system to measure canine glycoprotein 1 is a cofactor for tissue plasminogen activator-mediated heart size in radiographs. J Am Vet Med Assoc, 206 (2): 194-199, 1995. plasminogen activation. Arthritis Rheum, 60, 559-568, 2009. DOI: 10.1002/ 17. Hacariz O, Sayers G, Baykal AT: A proteomic approach to investigate art.24262 the distribution and abundance of surface and internal Fasciola hepatica 28. Kalenka  A,  Feldmann RE, Jr  Otero K, Maurer MH, Waschke KF, proteins during the chronic stage of natural liver fluke infection in cattle. Fiedler F: Changes in the  serum  proteome of patients with  sepsis  and J Proteome Res, 11, 3592-3604, 2012. DOI: 10.1021/pr300015p septic shock. Anesth Anal, 103, 1522-1526, 2006. DOI: 10.1213/01. 18. Trougakos IP, So A, Jansen B, Gleave ME, Gonos ES: Silencing ane.0000242533.59457.70 expression of the Clusterin/apolipoprotein J gene in human cancer cells 29. Zhi W,  Sharma A,  Purohit S, Miller E, Bode B, Anderson SW, Reed using small interfering RNA induces spontaneous apoptosis, reduced JC, Steed RD, Steed L, Hopkins D, She JX: Discovery and validation growth ability, and cell sensitization to genotoxic and oxidative stress. of  serum  protein changes in type 1  diabetes  patients using high Cancer Res, 64, 1834, 2004. throughput two dimensional liquid chromatography-mass spectrometry 19. García-Martínez JD,  Tvarijonaviciute A,  Cerón JJ, Caldin M, and immunoassays. Mol Cell  Proteomics, 10, 2011. DOI: 10.1074/mcp. Martínez-Subiela S: Urinary clusterin as a renal marker in dogs. J Vet M111.012203 Diagn Invest, 24, 301, 2012. DOI: 10.1177/1040638711435112 30. Kirk JA, Holewinski RJ, Kooij V, Agnetti G, Tunin RS, Witayavanitkul 20. Zhou X, Ma B, Lin Z, Qu Z, Huo Y, Wang J, Li B: Evaluation of the N, de Tombe PP, Gao WD, Van Eyk J, Kass DA: Cardiac resynchronization usefulness of novel biomarkers for drug-induced acute kidney injury in sensitizes the sarcomere to calcium by reactivating GSK-3β. J Clin Invest, beagle dogs. Toxicol App Pharmacol, 280, 30-35, 2014. DOI: 10.1016/j. 124 (1): 129-138, 2014. DOI: 10.1172/JCI69253 taap.2014.07.002 31. Seilhamer JJ, Arfsten A, Miller JA, Lundquist P, Scarborough RM, 21. Miyakis S,  Giannakopoulos B,  Krilis SA: Beta 2 glycoprotein Lewicki JA, Porter JG: Human and canine gene homologs of porcine I-function in health and disease. Thromb Res, 114, 335-346, 2004. DOI: brain natriuretic peptide. Biochem Biophys Res Commun, 165, 650-658, 10.1016/j.thromres.2004.07.017 1989. DOI: 10.1016/S0006-291X(89)80015-4 22. George  J, Harats D, Gilburd B, Afek A, Levy Y, Schneiderman J, 32. Keshishian H,  Addona T,  Burgess M, Kuhn E, Carr SA: Quantitative, Barshack I, Kopolovic J, Shoenfeld Y: Immunolocalization of beta2- multiplexed assays for low abundance proteins in plasma by targeted glycoprotein I (apolipoprotein H) to human  atherosclerotic plaques: mass spectrometry and stable isotope dilution. Mol Cell Proteomics, 6 potential implications for lesion progression. Circulation, 99 (17): 2227- (12): 2212-2229, 2007. 2230, 1999. DOI: 10.1161/01.CIR.99.17.2227 33. Liu T, Qian, WJ, Mottaz HM, Gritsenko MA, Norbeck AD, Moore 23. Wang WL, Meng ZX, Zhou SJ, Li CJ, Chen R, Lv L, Ma ZJ, Yu DM, RJ, Purvine SO, 2nd Camp DG , Smith RD: Evaluation of multi protein Yu P: Reduced beta2-glycoprotein I protects macrophages from ox-LDL- immunoaffinity subtraction for plasma proteomics and candidate induced foam cell formation and cell apoptosis. Lipids Health Dis, 12, 174, biomarker discovery using mass spectrometry. Mol Cell Proteomics, 5 (11): 2013. DOI: 10.1186/1476-511X-12-174 2167-2174, 2006. DOI: 10.1074/mcp.T600039-MCP200 24. Kim SY,  Park SM,  Lee ST: Apolipoprotein C-II  is a novel substrate for 34. Liu T,  Hossain M,  Schepmoes AA,Fillmore TL, Sokoll LJ, matrix metalloproteinases. Biochem Biophys Res Commun, 339 (1): 47- Kronewitter SR, Izmirlian G, Shi T, Qian WJ, Leach RJ, Thompson IM, 54, 2006. DOI: 10.1016/j.bbrc.2005.10.182 Chan DW, Smith RD, Kagan J, Srivastava S, Rodland KD, 2nd Camp 25. Kawano M, Kodama K,  Inadera H, Saito Y, Saito M, Yaginuma T, DG: Analysis of serum total and free PSA using immunoaffinity depletion Kanazawa Y, Kawakami M: A case of apolipoprotein C-II deficiency with coupled to SRM: Correlation with clinical immunoassay tests. J Proteomics, coronary artery disease. Clin Exp Med, 2 (1): 29-31, 2002. 75, 4747-4757, 2012. DOI: 10.1016/j.jprot.2012.01.035 Kafkas Univ Vet Fak Derg KafKas Universitesi veteriner faKUltesi Dergisi 22 (2): 281-286, 2016 JoUrnal Home-Page: http://vetdergi.kafkas.edu.tr Research Article DOI: 10.9775/kvfd.2015.14540 online sUbmission: http://vetdergikafkas.org Molecular Prevalence and Haematology of Tropical Theileriosis in Cholistani Cattle from Nomadic Herds of the Cholistan Desert, Pakistan Zaka SAEED 1 Furhan IQBAL 2 Mureed HUSSAIN 1 Rehan Sadiq SHAIKH 3 Umer FAROOQ 4 Atif AKBAR 5 Muhammad GULSHER 3 Muhammad Mazhar AYAZ 6 Syed Aamir MAHMOOD 1 Muhammad ALI 3 Munir AKTAS 7 1 Livestock and Dairy Development Department, Punjab, PAKISTAN 2 Bahauddin Zakariya University, Institute of Pure and Applied Biology, Multan, PAKISTAN 3 Bahauddin Zakariya University, Institute of Molecular Biology and Biotechnology, Multan, PAKISTAN 4 The Islamia University of Bahawalpur, University College of Veterinary and Animal Sciences, Bahawalpur, PAKISTAN 5 Bahauddin Zakariya University, Faculty of Statistics, Multan, PAKISTAN 6 Bahauddin Zakariya University, Faculty of Veterinary Sciences, Multan, PAKISTAN 7 Fırat University, Department of Parasitology, College of Veterinary Medicine, TR-23119 Elazığ - TÜRKİYE Article Code: KVFD-2015-14540 Received: 20.10.2015 Accepted: 24.12.2015 Published Online: 11.01.2016 Abstract This is the first report on tropical theileriosis in Cholistani cattle, with the aim of 1) assessing the reliability of PCR as a tool for diagnosis of the early/carrier state; 2) determining the prevalence of theileriosis; and 3) comparing haematological profiles of parasite-positive and parasite-negative cattle. A total of 264 cattle (142 female and 122 male; 127 adult and 137 young) were examined for tropical theileriosis through clinical examination, stained smear screening, and polymerase chain recation. No cattle showed clinical signs of the disease. Of the diagnostic tests, PCR was more sensitive for detection of the early/carrier state of theileriosis (19.3%) compared to stained thin blood smear examination (1.9%). Female (24.6%) and young animals (23.4%) showed higher prevalence than males and adults, but not significant (P>0.05). Prevalence of the disease (51.6%) was significantly higher (P<0.05) in summer. Haematological indices were not significantly different in parasite-positive compared to parasite-negative cattle, except for total protein and creatinine which were significantly higher in infected animals. The study revealed a substantial prevalence of tropical theileriosis in Cholistani cattle. Nevertheless, their adaptation to the climate and their potential for tick and disease resistance may reflect in the absence of clinical signs and in normal haematological indices. Keywords: Theileria annulata, Cattle, PCR, Pakistan Pakistan’ın Cholistan Çölünde Başıboş Dolaşan Cholistan Sığırlarında Tropikal Theileriosisin Prevalansı ve Kan Değerleri Özet Cholistan sığırlarında tropical theileriosis ile ilgili ilk rapor olan bu çalışma ile; 1 teşhis yöntemi olarak taşıyıcı hayvanlarda PCR metodunun güvenirliliğinin belirlenmesi; theileriosisin prevalansının tespit edilmesi; parazit pozitif ve negative bireylerde kan parametrelerinin karşılaştırılması hedeflenmiştir. Toplam 264 sığır klinik, mikroskopik ve PCR ile tropical theileriosis yönünden muayene edilmiştir. Sığırların hiç birinde klinik bulgu gözlenmemiştir. PCR (%19.3), subklinik enfeksiyonların belirlenmesinde mikroskopik bakıya (%1.9) göre oldukça duyarlı bulunmuştur. Hastalğın yaygınlığı dişi (24.6%) ve genç hayvanlarda (%23.4) erkek ve erişkinlere göre daha yüksek bulunmuş, ancak bu farklılığın istatistiksel olarak anlamlı olmadığı (P>0.05) görülmüştür. Hastalığın, yaz aylarında (%51.6) daha yüksek olduğu tespit edilmiştir. T. annulata yönünden pozitif ve negative hayvanların kan değerlerinde total protein ve creatinine hariç (bu değerler enfekte hanvanlarda yüksek bulunmuştur) bir farklılık gözlenmemiştir. Bu çalışma Cholistan sığırlarında hastalığın prevalansının yüksek olduğunu ortaya koymuştur. Muayene edilen hayvanların hiç birinde klinik bulguların gözlenmemesi, kan değerlerinde değişikliğin olmaması, bu sığırların kenelere ve hastalığa karşı dirençlerini yansıtmaktadır. Anahtar sözcükler: Theileria annulata, Sığır, PCR, Pakistan  İletişim (Correspondence)  +90 424 2370000; Fax: +90 424 2388173  maktas@firat.edu.tr 282 Molecular Prevalence and ... INTRODUCTION Blood and Tick Sampling Animals were examined for clinical signs (fever, enlarge- Pakistan has 15 indigenous breeds of cattle belonging ment of superficial lymph nodes, anemia, salivation and to zebu (one-humped) breed (Bos indicus), comprising [1] drop in milk production) and tick infestation. Approximately 43% of the cattle population . Cholistani cattle are 7 ml of blood was collected from the jugular vein under considered to be ancestral to the Sahiwal and are thermo- [2] appropriate restraint and stored as two aliquots: clotted tolerant, and tick-resistant . Tropical theileriosis, caused for harvesting serum and un-clotted (0.5 M EDTA) for DNA by Theileria annulata, is an important tick-borne disease of cattle in tropical and sub-tropical regions [3-6] extraction and haematological analysis. The body of each . The disease is transmitted by the tick Hyalomma [7,8]. Research has been animal was inspected by palpation for the presence of conducted in Pakistan on various aspects of this disease tick infestation, primarily on the ears, perineum, scrotum, in Sahiwal and crossbred cattle [6], as well as in sheep and udder, tail base, and along the nape of the neck. The ticks goats [9]. It is a serious constraint to cattle production in were manually removed and placed in 25 mL containers endemic areas, causing lethal infections in exotic cattle with perforated caps containing a small strip of filter or and considerable mortality in indigenous as well as in paper towel. The ticks were identified according to the crossbred stock [10]. Factors including Pakistan’s location in standard taxonomic keys using a stereomicroscope. a warm climate and extensive uncontrolled crossbreeding Microscopic Examination programmes have rendered it an endemic area for theileriosis [6]. Exotic cattle and their crossbreds are highly Thin blood smears were prepared, labelled, air dried, susceptible, while indigenous cattle are relatively resistant and transported to the Molecular Biology Laboratory of to tropical theileriosis [11]. Bahauddin Zakariya University. The smears were fixed in absolute methanol for 5 min, stained with 10% Giemsa The objectives of the study were to determine the stain for 30 min, and examined under oil immersion prevalence of T. annulata in Cholistani cattle from Pakistan (×1.000) for the presence of parasites. In each smear, 20 reared under desert nomadic conditions, to assess PCR as fields (minimum 5.000 erythrocytes) were screened for the a tool for diagnosis of the carrier state of the parasite, and presence of intra-erythrocytic Theileria piroplasms. to compare the haematological profiles of infected and uninfected cattle. DNA Extraction and PCR Amplification MATERIAL and METHODS DNA was extracted by an inorganic method [14]. PCR amplification was carried out through an optimized method described by Shahnawaz et al.[15] in which the 30 Geo-location and Study Animals kDa merozoite surface antigen of T. annulata was amplified The study was conducted from February 2013 to using a set of oligonucleotide primers. The forward [N516 January 2014 in the Cholistan desert of Pakistan. Location (5’- GTAACCTTTAAAAACGT-3’)] and the reverse [N517 (5’- and climatic conditions of the area have been described GTTACGAACATGGGTTT-3’)] primers were as described by [16] elsewhere [12]. This area is an extension of the Great Indian d’Oliveira et al. . A final reaction volume of 25 µL was Desert, which includes the Thar Desert in Sindh Province, used for the PCR. Each reaction contained 50 mM KCl, 10 Pakistan and the Rajhsatan desert in India. It is located mM Tris-HCl (pH 8.3), 1.5 mM MgCl, 0.1% Triton X-100, 30 km from the city of Bahawalpur, Punjab, Pakistan and 200 µM (each) deoxynucleotide triphosphate, 2.5 U of Taq covers an area of 26.000 km², from latitude 27º42´to DNA polymerase (Merck, USA), 20 pMol of primers, and 5 29º45´ North and longitude 69º52´to 75º24´ East [12]. The µL of extracted DNA sample. Positive control DNA from climate is arid subtropical continental with low/sporadic T. annulata (previously detected by PCR from a naturally rainfall, high temperature, low relative humidity, high rate infected cow) and sterilized de-ionized water (without of evaporation, and strong summer winds. It is the driest DNA) were run with each PCR amplification as positive and and hottest area of Pakistan, with summer spanning May negative controls, respectively. through October. Randomly selected artificial and natural reservoirs and ponds, called Tobas [12,13] in the desert were The sensitivity, specificity, positive predictive and visited to collect the samples during the study. Two- negative predictive values for for blood smear examination hundred-sixty-four Cholistani cattle (142 females and and for PCR were determined through an online calculator 122 males; 127 adult and 137 young) were examined in available at the web link (http://www.wikihow.com/ a survey approved by the Ethical Review Committee for Calculate-Sensitivity,-Specificity,-Positive-Predictive- the Use of Animals, under the administrative control of Value,-and-Negative-Predictive-Value). the Office of Research, Innovation, and Commercialization Haematological Analysis of Bahauddin Zakariya University. Written consent was obtained from the Cholistani pastoralists involved in An automated Haematology Analyzer (Sysmex K21, our study. Kobe, Japan) was used for determination of haematological 283 SAEED, IQBAL, HUSSAIN, SHAIKH, FAROOQ, AKBAR GULSHER, AYAZ, MAHMOOD, ALI, AKTAS indices including haemoglobin (Hb), packed cell volume RESULTS (PCV), total erythrocyte count (TEC), and total leukocyte count (TLC). Blood smears stained with Wright’s stain were A total of 200 ticks feding on cattle were collected. simultaneously prepared for differential leukocytic count Seventy-eight of the 264 (29.5%) examined cattle carried (DLC). Mean corpuscular volume (MCV), mean corpuscular at least one tick. The mean rate of infestation of cattle was haemoglobin (MCH), and mean corpuscular haemoglobin 2.6, with the number of ticks per animal ranging from 1 concentration (MCHC) were calculated. The haematology to 40. Taxonomic identification revealed that all the ticks analyzer was designed for human application; hence, before were belonged to the species Hyalomma anatolicum. analysis of samples, it was validated against blood samples from 100 dogs and 100 cows as well as with manual None of the cattle exhibited clinical signs of tropical reference methods (cynmethaemoglobin photometry, theileriosis. Prevalence, as detected through blood smear haematocrit analysis, and haemocytometry) [17]. Total examination and PCR, was 1.9 (5/264; CI 0.25-3.53) and protein (TP), creatinine, alanine transaminase (ALT), aspartate 19.3% (51/264; CI 14.5-24.1) respectively (Table 1). Microscopic transaminase (AST), and triglycerides (TGs) were determined findings were confirmed by PCR positive signals for by using APEL PD-303S spectrophotometer (Japan) and Theileria annulata. All PCR positive samples produced diagnostic kits (Spinreact, Spain), following the manufacturer’s the 721 bp fragment specific for T. annulata. Sensitivity, instructions. specificity, positive predictive, and negative predictive values for blood smear examination were 8.9, 45.1, 1.8, and Statistical Analysis 80.6%, respectively. Similar values for PCR were 91.0, 54.8, The data were classified according to sex, age, and 19.3, and 98.1%, respectively. season. Animals were categorized as adolescent (≥ 24 Prevalence of tropical theileriosis in females was higher, months) or adult (<24 months). Seasons were designated but not significantly (P>0.05), than in males at 24.6% as temperate spring (February through April), hot dry (35/142; CI 17.5-31.7) vs. 13.1% (16/122; CI 7.1-19.1). A summer (May through July), hot humid summer (August similar non-significant (P>0.05) difference in prevalence through October), and cool dry winter (November through was found between adolescent and adult cattle at January). Results for sex and age are presented as odds ratio 23.4% (32/137; CI 16.3-30.4) vs. 15% (19/127; CI 8.8- with 95% confidence intervals, and seasonal fluctuation 21.2). Significant differences in prevalence of the disease was assessed through Mantel-Haenszel c2 test using were found among seasons (P<0.05) (Table 1). Highest Minitab v. 16. Significance was considered at P<0.05. The prevalence was in hot dry summer at 51.6% (33/64; CI 39.2- difference in haematological profile of parasite-positive 63.8), followed by that in cold dry winter (14.5%; CI 5.7- and parasite-negative animals was calculated through 23.3), temperate spring (7.9%; CI 1.8-13.9) and hot humid an un-paired t-test. Predictive values were determined summer (4.8%; CI 0.5-10.2) (Table 1). through sensitivity and specificity of smear examination and PCR results. Haematological parameters of parasite-positive and Table 1. Association between the presence of Theileria annulata infection in Cholistani cattle detected by PCR and the studied parameters (sex, age, season) Tablo 1. Sığırlarda PCR ile tespit edilmiş Theileria annulata enfeksiyonu ile bazı parametreler (cinsiyet, yaş, mevsim) arasındaki ilişki Parameters No.of Sample Positive no. of Cattle (PCR) Odds Ratio/P-value* Gender Female 142 35 (24.6%; CI 17.5-31.7)** 2.17 [reciprocal =0.46] Male 122 16 (13.1%; CI 7.1-19.1) Total 264 51 (19.3%; CI 14.5-24.1) Age Adult 127 19 (15%; CI 8.8-21.2) 0.58 [reciprocal =1.73] Young 137 32 (23.4%; CI 16.3-30.4) Season Temperate spring 76 6 (7.9%; CI 1.8-13.9) Hot Dry Summer 64 33 (51.6%; CI 39.2-63.8) Mantel-Haenszel X2 P=0.392 Hot Humid Summer 62 3 (4.8%; CI 0.5-10.2) Cold Dry Winter 62 9 (14.5%; CI 5.7-23.3) * Odds Ratio/P-value analyses show the PCR results, ** 95% CI: Confidence Interval 284 Molecular Prevalence and ... parasite-negative cattle showed no significant differences, from Pakistan for cross-bred cattle through blood smear except for total protein and creatinine, which were examination [6]. A prevalence of 23% has been reported significantly higher in infected animals (Table 2). in Sahiwal cattle in Pakistan using PCR [28]. An absence of clinical signs of the disease and its lower prevalence in DISCUSSION Cholistani cattle in the present study may indicate that they are resistant to the disease. This is the first study on Cholistani cattle directed Higher prevalence of T. annulata found in females is towards assessment of PCR as a reliable diagnostic tool similar to previous reports [29,33]. There is only one report, for carrier state of theileriosis, deducing its prevalence from Egypt, of higher prevalence of T. annulata in males and assessing effect of the disease on haematological than in females [34]. This difference can be attributed to indices. Absence of clinical signs of theileriosis, despite ecological/geographical factors and differences in housing being infested with ticks, may be indicative of innate systems. The Cholistani nomadic pastoralists are moving in resistance of Cholistani cattle as previously reported for search of food and water. This livestock production system zebu cattle [12,13,18]. Haematological parameters showed a could be a feature responsible for the difference between consistent pattern throughout the seasons, without showing males and females, since both male and female cattle are variation with respect to level of weather-induced stress [2,12]. equally exposed to tick infestation [12]. The conventional diagnostic tools for theileriosis and babesiosis are being replaced by modern, sensitive, and Young animals showed a higher prevalence than did [6,15] specific molecular diagnostic methods such as PCR and adults, consistent with other reports . Innate immunity in [35] PCR-based reverse line blotting [15,19-26]. In the present calves is not developed enough to combat T. annulata . study, the prevalence of T. annulata found was significantly A higher prevalence of T. annulata in hot dry summer is higher with PCR as compared to that with blood smear in line with various reports [6,15]. High ambient temperature examination. This is in accord with earlier reports that in this season provides an environment conducive to stained smear blood examination cannot detect all sub- growth and multiplication of ticks and ultimately increases clinical or chronic infections, because parasitemia is often the transmission of theileriosis [6]. extremely low and may be missed [4,27]. Several reports have clearly demonstrated that PCR is a more sensitive and In this study, no haematological index showed specific test than the conventional thin blood smear [28-30] difference in positive cattle compared to non-infected and is reliable for detecting early or carrier infections. cattle. This is in contrast to most previous reports that document significantly lower TEC, Hb, and PCV values in The prevalence of T. annulata is higher in exotic and theileriosis-affected cattle [36,37]. These alterations have been cross-bred cattle than in locally-adapted zebu breeds [6,31]. attributed to parasitaemia-induced-anaemia and immune- The overall prevalence in Cholistani cattle in the present mediated erythrophagocytosis [37]. The lack of difference in study as detected through PCR was lower than the haematological indices of T. annulata infection Cholistani 24% reported for Holstein-Friesian at Pattoki region of cattle in this study may indicate an innate potential to Pakistan [32]. A prevalence of 33% has been reported maintain haematological parameters at consistent levels Table 2. Haematological profile of parasite-positive and parasite-negative blood samples from Cholistani cattle Tablo 2. Cholistan sığırlarından elde edilen parazit pozitif ve negatif kan örneklerinde hematolojik profil Parameters Positive (n = 51) Negative (n = 213) P-value Total Leukocyte Count (1012/L) 9.8±0.3 10.5±0.52 0.2 (NS) Total Erythrocyte Count (106/L) 7.5±0.2 7.5±0.1 0.8 (NS) Haemoglobin (g/dL) 10.7±0.2 11.1±0.1 0.1 (NS) Packed Cell Volume (%) 36.0±1.7 35.8±0.6 0.9 (NS) Mean Corpuscular Volume (fL) 48.0±1.7 48.3±0.7 0.8 (NS) Mean Corpuscular Haemoglobin (pg) 15.2±0.7 15.3±0.2 0.8 (NS) Mean Corpuscular Haemoglobin Concentration (g/dL) 31.1±0.7 32.1±0.3 0.1 (NS) Total Protein (g/dL) 6.9±0.1 7.3±0.9 0.03* Creatinine (mg/dL) 1.5±0.5 1.3±0.02 0.01* Alanine Transaminase (U/L) 28.6±1.5 28.8±0.5 0.8 (NS) Aspartate Transaminase (U/L) 58.8±2.7 57.1±1.2 0.5 (NS) Triglycerides (mg/dL) 24.5±0.6 26.0±0.5 0.06 (NS) Values are mean ±SEM, NS: Non significant, * P<0.05 285 SAEED, IQBAL, HUSSAIN, SHAIKH, FAROOQ, AKBAR GULSHER, AYAZ, MAHMOOD, ALI, AKTAS regardless of stressors, as reported by Farooq et al.[2]. Preston PM: Bovine cells infected in vivo with Theileria annulata express Among biochemical factors, total protein was significantly CD11b, the C3bi complement receptor. Vet Res Commun, 21, 249-263, 1997. DOI: 10.1023/A:1005886725717 decreased in infected cattle. This is in agreement with 11. Beniwal RK, Nichani AK, Sharma RD, Rakha NK, Suri D, Sarup S: previous reports of decreased serum proteins in affected Responses in animals vaccinated with the Theileria annulata (Hisar) cell cattle. This decrease has been attributed to effects on culture vaccine.  Trop Anim Health Prod, 29, 109-113, 1997. DOI: 10.1007/ lymph nodes in the diseased animals, resulting in extra- BF02632947 vascular proteinaceous fluid in body cavities [38]. 12. Farooq U, Samad HA, Sher F, Asim M, Khan MA: Cholistan and Cholistani breed of cattle. Pak Vet J, 30, 126-130, 2010. The present study revealed a substantial prevalence 13. Farooq U, Mahmood SA, Ahmad I, Ahmad N, Idris M, Abbas MT: of theilerial infection in Cholistani cattle reared by the Evaluation of post thaw sperm parameters and fertility of Cholistani nomads of Cholistan. However, their adaptation to the service bulls. Turk J Vet Anim Sci, 39, 472-479, 2015. DOI: 10.3906/vet-1502-27 climate and their potential for disease resistance may 14. Shaikh R, Ramzan K, Nazil S, Sattar S, Khan SN, Raizuddin S, Ahmed ZM, Friedman TB: A new locus for nonsyndromic deafness evident from absence of clinical signs and un-affected DFNB51 maps to chromosomes 11p 13-p12. Am J Med Genet, 138, 295- haematological indices as observed in present study. 392, 2005. DOI: 10.1002/ajmg.a.30949 This could indicate the state of endemic stability, which 15. Shahnawaz S, Ali M, Aslam MA, Fatima R, Chauhdry ZI, Hassan needs further research. Uncontrolled cross-breeding MU, Ali M, Iqbal F: A study on the prevalence of a tick-transmitted and mixed farming being carried out by the nomads of pathogen, Theileria annulata, and hematological profile of cattle from Southern Punjan (Pakistan). Parasitol Res, 109, 1155-1160, 2011. DOI: Cholistan desert, Pakistan might be a source of infection- 10.1007/s00436-011-2360-1 transfer from this endemically stable population to other 16. d’Oliveira C, Van der Weide M, Habela MA, Jacquiet P, Jongejan F: livestock. Future research needs to be directed towards Detection of Theileria annulata in blood samples of carrier cattle by PCR. the assessment of blood biomarkers in Cholistani cattle J Clin Microbiol, 33, 2665-2669, 1995. that may be associated with T. annulata resistance. 17. Wassmuth AK, Riond B, Hofmann-Lehmann R, Lutz H: Evaluation of the Mythic 18 hematology analyzer for use with canine, feline, and equine samples. J Vet Diagn Invest, 23, 436-453, 2011. DOI: 10.1177/ Acknowledgement 1040638711403416 18. Hansen PJ: Physiological and cellular adaptations of Zebu cattle This study was a part of PhD research by Zaka Saeed to thermal stress. Anim Reprod Sci, 82, 349-360, 2004. DOI: 10.1016/j. and was funded by the Higher Education Commission anireprosci.2004.04.011 (HEC) of Pakistan vide their Indigenous PhD Scholarship 19. Aktas M, Altay K, Dumanli N: Survey of Theileria parasites of sheep Scheme. in eastern Turkey using polymerase chain reaction. Small Rumin Res, 60, 289-293, 2005. DOI: 10.1016/j.smallrumres.2005.01.002 20. Aktas M, Altay K, Dumanli N: Determination of prevalence and risk REFERENCES factors for infection with Babesia ovis in small ruminants from Turkey by polymerase chain reaction. Parasitol Res, 100, 797-802, 2007. DOI: 1. Moaeen-ud-Din M, Bilal G, Khan MS: Potential of genomic selection 10.1007/s00436-006-0345-2 in Sahiwal cattle. Pak J Agri Sci, 51, 697-702, 2014. 21. Altay K, Aktas M, Dumanli N, Aydin MF: Evaluation of a PCR and 2. Farooq U, Ijaz A, Ahmed N, Rehman H, Zaneb H: Haematologic comparison with RLB for detection and differentiation of Theileria sp. MK profile revisited: Adult Cholistani breeding bulls as a model. J Anim Plant and other Theileria and Babesia species of small ruminants. Parasitol Res, Sci, 22, 835-839, 2012. 103, 319-323, 2008. DOI: 10.1007/s00436-008-0973-9 3. Aktaş M, Sevgili M, Dumanli N, Karaer Z, Çakmak A: Seroprevalance 22. Altay K, Dumanli N, Aktas M: A study on ovine tick-borne of Theileria annulate in Elazig, Malatya and Tunceli Provinces. Turk J hemoprotozoan parasites (Theileria and Babesia) in the East Black Sea Vet Anim Sci, 25 (3): 359-363, 2001. Region of Turkey. Parasitol Res, 111, 149-153, 2012. DOI: 10.1007/s00436- 4. Aktas M, Dumanli N, Çetinkaya B, Cakmak A: Field evaluation of 011-2811-8 PCR in detecting Theileria annulata infection in cattle in the east of Turkey. 23. Heidarpour Bami M, Haddadzadeh HR, Kazemi B, Khazraiinia P, Vet Rec, 150, 548-549, 2002. DOI: 10.1136/vr.150.17.548 Bandehpour M, Aktas, M: Molecular identification of ovine Theileria 5. Dumanli N, Aktas M, Cetinkaya B, Cakmak A, Koroglu E, Saki CE, species by a new PCR-RFLP method. Vet Parasitol, 161, 171-177, 2009. DOI: Erdogmus Z, Nalbantoglu S, Ongor H, Simşek S, Karahan M, Altay 10.1016/j.vetpar.2009.01.035 K: Prevalence and distribution of tropical theileriosis in eastern Turkey. 24. Iqbal F, Fatima M, Shahnawaz S, Naeem M, Shaikh R, Ali M, Shaikh Vet Parasitol, 127, 9-15, 2005. DOI: 10.1016/j.vetpar.2004.08.006 A, Aktas M, Ali M: A study on the determination of risk factors associated with babesiosis and prevalence of Babesia sp., by PCR amplification, in 6. Qayyum A, Farooq U, Samad HA, Chauhdry HR: Prevalence, small ruminants from Southern Punjab (Pakistan). Parasite, 18, 229-234, clinicotherapeutic and prophylactic studies on theileriosis in district 2011. Sahiwal (Pakistan). J Anim Plant Sci, 20, 266-270, 2010. 25. Iqbal F, Khattak R, Ozubek S, Khattak M, Rasul A, Aktas M: 7. Aktas M, Dumanli N, Angin M: Cattle infestation by Hyalomma ticks Application of the reverse line blot assay for the molecular detection of and prevalence of Theileria in Hyalomma species in the east of Turkey. Theileria and Babesia sp. in sheep and goat blood samples from Pakistan. Vet Parasitol, 119, 1-8, 2004. DOI: 10.1016/j.vetpar.2003.10.013 Iran J Parasitol, 8, 289-295, 2013. 8. Aktas M: A survey of ixodid tick species and molecular identification 26. Akat A, Aktaş M, Dumanli N, Turgut-Balik D: Isolation, cloning of tick-borne pathogens. Vet Parasitol, 200, 276-283, 2014. DOI: 10.1016/j. and sequence analysis of enolase enzyme encoding gene from Theileria vetpar.2013.12.008 annulata for assessment of important residues of this enzyme. Kafkas 9. Irshad N, Qayyum M, Hussain M, Qasim KM: Prevalence of tick Univ Vet Fak Derg, 20, 243-248, 2014. DOI: 10.9775/kvfd.2013.9932  infestation and theileriosis in sheep and goats. Pak Vet J, 30, 178-180, 27. Aktas M, Altay K, Nazir D: A molecular survey of bovine Theileria 2010. parasites among apparently healthy cattle and with a note on the 10. Forsyth L, Jackson MG, Wilkie LA, Sanderson GA, Brown CGD, distribution of ticks in Eastern Turkey. Vet Parasitol, 138, 179-185, 2006. 286 Molecular Prevalence and ... DOI: 10.1016/j.vetpar.2006.01.052 33. Inci A, Ica A, Yildirim A, Vatansever Z, Cakmak A, Albasan H, 28. Durrani AZ, Mehmood N, Shakoori AR: Comparison of three Cam Y, Atasever A, Duzlo O: Epidemiology of tropical theileriosis in diagnostic methods for Theileria annulata in Sahiwal and Friesian cattle in the Cappadocia region. Turk J Vet Anim Sci, 32, 57-64, 2008. Pakistan. Pak J Zool, 42, 467-472, 2010. 34. Abdel-Rady A, Ahmed LS, Mohamed A, Al-Hosary A: Epidemiological 29. Khattak RM, Rabib M, Khan Z, Ishaq M, Hameed H, Taqddus A, studies on bovine theileriosis in upper Egypt. IJAVMS, 4, 67-74, 2010. Faryal M, Durranis S, Gillani QUA, Allahyar R, Shaikh RS, Khan MA, Ali 35. Ahmed JS, Glass EJ, Salih DA, Seitzer U: Review: Innate immunity M, Iqbal F: A comparison of two different techniques for the detection of to tropical theileriosis. Innate Immunity, 14, 5-12, 2008. DOI: 10.1177/ blood parasite Theileria annulata in cattle from two districts in Khyber 1753425907087258 Pukhtoon Khwa province (Pakistan). Parasitology, 19, 91-95, 2012. DOI: 36. Col R, Uslu U: Changes in selected serum components in cattle 10.1051/parasite/2012191091 naturally infected with Theileria annulata. Bull Vet Inst Pulawy, 51, 15-18, 30. Kohli S, Atheya UK, Thapliyal A: Prevalence of theileriosis in 2007. cross-bred cattle: Its detection through blood smear examination and 37. Khan IA, Khan A, Hussain A, Riaz A, Aziz A: Hemato-biochemical polymerase chain reaction in Dehradun district, Uttarakhand. Indian alterations in cross bred cattle affected with bovine theileriosis in semi Vet World, 7, 168-171, 2014. DOI: 10.14202/vetworld.2014.168-171 arid zone. Pak Vet J, 31, 137-140, 2011. 31. Tabidi MH, Hassan OM, El Jalii IM, Hamza AE: Surveillance of 38. Stockham SL, Kjemtrup AM, Conrad PA, Schmidt DA, Scott theileriosis in selected dairy farms in Khartoum and Gazeira States-Sudan. MA, Robinson TW, Tyler JW, Johnson GC, Carson CA, Cuddihee P: J Anim Vet Adv, 5, 1043-1045, 2006. Theileriosis in a Missouri beef herd caused by Theileria buffeli: case report, herd 32. Zahid IA, Latif M, Baloch KB: Incidence and treatment of theileriosis investigation, ultrastructure, phylogenetic analysis, and experimental and babesiosis. Pak Vet J, 25, 137-139, 2005. transmission. Vet Pathol, 37, 11-21, 2000. DOI: 10.1354/vp.37-1-11 Kafkas Univ Vet Fak Derg KafKas Universitesi veteriner faKUltesi Dergisi 22 (2): 287-289, 2016 JoUrnal Home-Page: http://vetdergi.kafkas.edu.tr Short Communication DOI: 10.9775/kvfd.2015.13797 online sUbmission: http://vetdergikafkas.org An Investigation on the Relationship between the Azoospermia- Like (DAZL) Gene mRNA Expression and the Infertility in Male Cattle-Yak Yincang HAN 1 Yong FU 1 1 Academy of Animal Science and Veterinary Medicine, Qinghai University, Xining, 810016, CHINA Article Code: KVFD-2015-13797 Received: 31.05.2015 Accepted: 16.12.2015 Published Online: 19.01.2016 Abstract This study was conducted to study the relationship between the infertility of male cattle-yak and the expression level of DAZL gene mRNA. The expression profiles were obtained by RT-PCR. The DAZL gene was specifically expressed in cattle, yak and cattle-yak testis tissues,which confirmed its important role in the progression of cell cycle. Real-time quantitative PCR analysis indicated that the expression levels of DAZL gene in cattle and yak testis were higher than its in cattle-yak, also cattle-yak and yak were significantly differet than cattle, respectively (P<0.05). Therefore, the low expression level of DAZL gene might result in male cattle-yak infertility. Keywords: Male infertility, DAZL, Real-time quantitative PCR, Phylogenetic relationship Sığır-Yak Melezlerinde Azoospermia-Benzeri (DAZL) Gen mRNA Ekspresyon Düzeyi ile İnfertilite Arasındaki İlişki Üzerine Bir Araştırma Özet Bu çalışma erkek sığır-yak melezlerinde Azoospermia-Benzeri (DAZL) gen mRNA ekspresyon düzeyi ile infertilite arasındaki ilişkiyi araştırmak amacıyla yapılmıştır. Ekspresyon seviyeleri RT-PCR ile belirlendi. DAZL geninin spesifik olarak sığır, yak ve sığır-yak melezi testis dokularında eksprese edilmesi hücre siklusunun ilerlemesinde önemli rolü olduğunu teyit etmekteydi. Gerçek Zamanlı kantitatif PCR analizi sığır ve yak testis dokularında DAZL gen ekspresyon düzeyinin sığır-yak melezlerindekinden daha fazla olduğunu ve sığır-yak melezi ve yaklardaki seviyelerin anlamlı derecede sığırlardan farklı olduğunu göstermekteydi (P<0.05). Sonuç olarak, düşük DAZL gen ekspresyonu erkek sığır-yaklarda infertiliteye neden olabilir. Anahtar sözcükler: Erkek infertilite, DAZL, Gerçek zamanlı kantitatif PCR, Filogenetik ilişki INTRODUCTION phenomenon, but the main reason about the males sterile was had not found. Genes of the DAZ (Deleted in Yak is the main livestock on the Qinghai-Tibetan Azoospermia) gene famiv, DAZ, DAZL and BOULE, DAZL was Plateau, which belong the unique topographic features originated from BOULE on Chromosome 2q, BOULE is the and the original bovine. It has high coarse, cold-resistant ancestral gene of DAZ gene family on Chromosome 3q [3]. characteristics which adapts alpine hypoxia environment, The DAZL gene which is being studied in animal infertility but its milk, and meat production performances are lower. at present is the research focus [4]. A lot of studies indicates In order to improve the production performance of yak, yak that the absence of DAZL gene or the base mutation of is crossbred with cattle. Thus the production performance DAZL gene brings on meiosis arrest and spermatogenic of hybrid cattle-yak which were in growth, fleshy, labor failure, which may lead to azoospermia and male infertility [5-8]. force and production performance were significantly better than the those of yak, but the infertility of male At present, the study of the relationship between the cattle-yak has been greatly limited in the production and infertility of cattle-yak and the expression level of DAZL breeding [1,2]. gene is rare. In this study, combined with cattle and yak, the DAZL gene from 3 representative Qinghai-Tibetan Plateau Over the past decades, the cattle-yak males sterile were Bovine breeds were amplified, sequenced, Real-time PCR significant studied by a lot of scholars about the complex was amplified and data was analyzed to provide theoretic  İletişim (Correspondence)  +86 971 5315935  657401786@qq.com 288 An Investigation on the ... basis which finally revealed the infertility of cattle-yak vector and then transformed into Escherichia coli DH5a mechanism. (TIANGEN, Beijing, China). The positive clone plasmid which was extracted according to the manufacturer’s MATERIAL and METHODS protocol (Sangon, Shanghai, China) was identified and sequenced (Sangon, Shanghai, China). Specimen Collection Real-time quantitative PCR which was performed The tissues samples of bovine breeds were collected on a DNA amplification machine (ABI, USA) was used to from the Guomaying Town in Qinghai province. Male cattle- quantitatively determine the expression level of Dazl yaks (n=10), male cattle (n=10) and male yaks (n=10) gene in various bovine testical tissues. Real-time PCR was which were adult and healthy were slaughtered. Testis, performed in a 20 μL reaction mixture containing 2 μL epididymis, hypothalamus, pituitary, heart, liver, spleen RT products,10 μL SYBR Premix Ex TaqTM II (2×) (TaKaRa, and pectoral muscle were removed and frozen in liquid Dalian, China), 0.4 μL Rox Reference Dye II (50×) (TaKaRa, nitrogen. Dalian, China), 0.8 μL of 10 μM of each oligonucleotide primer, and 6 μL ddH2O. Real-time PCR cycle conditions Design of Primers were 1cycle of 95°C for 30 s, 40 cycles of 95°C for 5 s, 57°C for 20 s and 72°C for 34 s and 1 cycle of 95°C for 15 s, 60°C The β-actin gene was used as an internal control. The for 1 min and 95°C for 15 s. The plasmid of positive clone primers were designed according to the cattle DAZL gene fragment was standard after gradient dilution to make the sequence (GenBank Accession Number: EF501823.2) and standard curve. The quantitative results were performed β-actin gene sequence (GenBank Accession Number: using SPSS17.0 software for statistical analysis. NM_173979) using primer 3.0 software and synthesized (Sangon, Shanghai, China). The primers for DAZL gene were: 5’-TCCTCCTCCACCACAATTTC-3’and 5’-GCTCCGGTG RESULTS TCAACTTCATT-3’. The primers for β-actin were: 5’-TCCCTGG AGAAGAGCTACGA-3’and 5’-TAGAGGTCCTTGCGGATGTC-3. The Expression Profile of DAZL Gene Total RNA Isolation and cDNA Synthesis According to the DNA marker and the sequencing results, the size of DAZL and β-actin expected PCR products Total RNA from the cattle, yak and cattle-yak tissues were 270 bp and 179 bp. The expression of DAZL gene (testis, epididymis, hypothalamus, pituitary, heart, liver, in cattle, yak and cattle-yak tissues (testis, epididymis, spleen and muscle) were extracted using standard methods hypothalamus, pituitary, heart, liver, spleen and muscle) according to the manufacturer’s protocol (RNA Extraction was detected by RT-PCR. The results showed that DAZL Kit, Fastagen, Shanghai, China). The cDNA was synthesized gene was expressed specifically in cattle and yak testises, according to the manufacturer’s protocol (Reverse Trans- but not in other tissues. cription Kit TaKaRa, Dalian, China). Operation procedure: 10 μg of purified total RNA, Prime ScriptTM RT Enzyme The mRNA Expression Level of DAZL Gene Mix1 1 μL, Oligo (dT) primer 1 μL, Random primer1 μL, The mRNA expression level of DAZL gene was analyzed 5×Primer ScriptTM Buffer 4 μL and RNase Free ddH2O in a by Real-time PCR (Fig. 1). The results showed (Table 1) final volume of 20 μL.The RT temperature profile was 37°C that the mRNA expression level of DAZL gene in cattle for 15min, 85°C for 15 s, and final cooling to 4°C. The cDNA (8.3980±2.26146) and yak (1.2020±0.70539) testical tissues was stored at -20°C until use. were higher than its in cattle-yak (0.9810±0.25899). Cattle- PCR Amplification, Molecular Cloning and yak crossbred and yak were significantly different than Real-time PCR Amplification cattle, respectively (P<0.05). PCR was carried out in a 25 μL reaction mixture DISCUSSION containing 5 μL RT products, 12.5 μL 2×PCR buffer (Sangon, Shanghai, China), 0.6 μL of 10 mM of each oligonucleotide Yaks are main breeds of Qinghai-Tibet Plateau, cattle primer, and ddH2O in a final volume of 25 μL. PCR was yaks, the F1 hybrid between cattle and yaks, exhibit performed on a DNA amplification machine (ABI, USA) significant hybrid vigor. However, the males are sterile, with an initial denaturation at 94°C for 4 min, 40 cycles of which greatly restricts the utilization of this hybrid vigor. 94°C for 50 s, 57°C for 30 s and 72°C for 30 s and a final extension step of 7 min at 72°C. Reaction products were The DAZL gene, a member of the DAZ gene family, run on 2% agarose gels stained with ethidium bromide, which shows a specific expression in germ cells, is the key and the target bands purifed with a Gel Extraction Kit regulation factors during meiosis of human and animal (OMEGA, Shanghai, China) according to the manufacturer’s spermatogenesis [9,10]. The absence of DAZL gene brings protocol. The purifed product was cloned into the pGM-T on meiosis to arrest and failure of spermatogenesis, 289 HAN, FU Fig 1. Developmental changes of expression level of DAZL gene mRNA expression in cattle, yak and cattle-yak’s testises. Note: Different letters show significant differences at P<0.05 Şekil 1. Sığır, yak ve sığır-yak melezlerinin testislerindeki DAZL geninin mRNA ekspresyon seviyesindeki değişiklikler. Farklı harfler anlamlı farkın olduğunu göstermektedir (P<0.05) Table 1. The variance analysis of DAZL gene’s mRNA expression level in cattle, yak and cattle-yak’s testis tissues Tablo 1. Sığır, yak ve sığır-yak melezlerinin testis dokusunda DAZL genine ait mRNA ifade seviyesinin varyans analizi DAZL gene The Source of Variation Sum of Squares df Mean Square F Between the species 356.144 2 178.072 94.071* Within the category 51.110 27 1.893 Total variation 407.253 29 * means hows that differences significantly important which may lead to infertility of animal [11]. So presumably 2. Qu XG, Li QF, Liu ZS, Dong LY, Li XF, Hao CL, Xie Z: The study on DAZL gene in also plays an important role in cattle-yak the expression level of SYCP3 mRNA in Yak and Cattle-yak testis. Acta Vet Zootech Sinica, 39, 1132-1136, 2008. spermatogenesis. 3. Yen PH, Chai NN, Salido EC: The human autosomal gene DAZL A: In this study, to understand the function of the bovine testis specificity and a candidate for male infertility. Hum Mol Genet, 5, 2013-2017, 1996. DAZ gene family. The DAZL gene was highly expressed in 4. Reynolds N, Cooke HJ: Role of the DAZ genes in male fertility. Reprod bovine testis showing normal spermatogenesis but the case Biomed online, 10, 72-80, 2005. DOI: 10.1016/S1472-6483(10)60806-1 that mRNA level was low in testis possibly shows a defect 5. Yen PH: Putative biological functions of the DAZ family. Int J Androl, in spermatogenesis, which suggest that DAZL gene might 27, 125-129, 2004. involve in spermatogenesis in the bovine testical tissue 6. Tschanter P, Kostova E, Luetjens C M, Cooper TG, Nieschlag and arresting its transcription might result in infertility for E, Gromoll J: No association of the A260G and A386G DAZL single male cattle-yak crossbred. Taken together with the report nucleotide polymorphisms with male infertility in a Caucasian population. of DAZL gene [12], the result of low expression level of Hum Reprod , 19, 2771-2776, 2004. DAZL gene in cattle-yak testis suggests that DAZL gene 7. Xu EY, Moore FL, Pera RA: A gene family required for human germ cell development evolved from an ancient meiotic gene conserved in might be associated with reproduction, which provide a metazoans. Proc Natl, 98, 7414-7419, 2001. theoretical basis of study the relationship between male 8. Lin YM, Kuo PL, Lin YH, Eeng YN, Nan Lin JS: Messenger RNA sterility of cattle-yak and DAZL gene. transcripts of the meiotic regulation or BOULE in the testis of azoospermic men and their application in predicting the success of sperm retrieval. Acknowledgements Hum Reprod, 20, 782-788, 2005. DOI: 10.1093/humrep/deh647 9. Tung JY, Luetjens CM, Wistuba J, Xu EY, Reijo Pera RA: Evolutionary This work was supported by the agricultural science and comparison of the reproductive genes, DAZL and BOULE in primates with and without DAZ. Dev Genes Evol, 216, 158-168, 2006. DOI: 10.1007/ technology achievements transformation and extension s00427-005-0039-2 of Qinghai province (No. 2013-N-517), and the National 10. Xu H, Li M, Gui J, Hong Y: Cloning and expression of medaka DAZL Spark Program of P.R. China (No. 2014GA870001). during embryogenesis and gametogenesis. Gene Expression Patterns, 7, 332-338, 2007. REFERENCES 11. Liu WS, Wang A, Uno Y, Galitz D, Beattie CW, Ponce de Leon FA: Genomic structure and transcript variants of the bovine DAZL gene. 1. Ding FH, Wei YP, Xu JT, Tong ZB, Ma ZJ, Chen SM, You La CR, Lou Cytogenet Genome Res, 116, 65-71, 2007. XL: The comparisons of the performance of yak, Pianniu and yellow 12. Zhang QB, Li QF, Li JH, Li XF, Liu ZS, Song DW, Xie Z: b-DAZL: A cattle, and the determination of fiavour in the muscle. J Qinghai Univ, 26, novel gene in bovine spermatogenesis. Prog Nat Sci, 18, 1209-1218, 2008. 7-10, 2008. DOI: 10.1016/j.pnsc.2008.02.012 Kafkas Univ Vet Fak Derg KafKas Universitesi veteriner faKUltesi Dergisi 22 (2): 291-296, 2016 JoUrnal Home-Page: http://vetdergi.kafkas.edu.tr Short Communication DOI: 10.9775/kvfd.2015.14291 online sUbmission: http://vetdergikafkas.org Isolation and Identification of High Lactic Acid Producer Bacteria from Forage and Their Silages Grown in Different Ecologies [1] Mustafa KIZILŞİMŞEK 1 Mustafa KÜSEK 2 Yekta GEZGİNÇ 3 Adem EROL 1 [1] This research is a part of project 110O694 supported by TUBITAK 1 Kahramanmaraş Süçü İmam Üniversitesi, Ziraat Fakültesi, Tarla Bitkileri Bölümü, TR-46100 Kahramanmaraş - TÜRKİYE 2 Kahramanmaraş Süçü İmam Üniversitesi, Ziraat Fakültesi, Bitki Koruma Bölümü, TR-46100 Kahramanmaraş - TÜRKİYE 3 Kahramanmaraş Süçü İmam Üniversitesi, Ziraat Fakültesi, Gıda Bilimi ve Teknolojisi Bölümü, TR-46100 Kahramanmaraş - TÜRKİYE Article Code: KVFD-2015-14291 Received: 25.08.2015 Accepted: 30.12.2015 Published Online: 13.01.2016 Abstract In total, 695 Lactic acid bacteria isolation was made from forage crops grown in a wide part of Turkey’s rangeland flora and their silages. A big majority of isolated strains (531) could regenerate. All regenerated isolates were incubated in MRS agar media containing CaCO3 in order to determine their total organic acid production. Selected 70 isolates according to their organic acid production were incubated in MRS broth media and their lactic acid productions were determined. High lactic acid producer 10 isolates were selected among treated isolates and they were identified using BIOLOG device in terms of their individual usage of different carbohydrate source during incubation period. Keywords: LAB, Identification, Isolation, Silage, Fermentation Products Farklı Ekolojilerdeki Yem Bitkilerinden ve Silajlarından Yüksek Laktik Asit Üreten Bakteri İzolasyonu ve Tanımlanması Özet Türkiye’nin geniş bir bölümündeki meralarda bulunan yem bitkilerinden ve bunların silajlarından 695 adet LAB izolasyonu yapılmıştır. Elde edilen izolatlardan önemli bir çoğunluğu (531 adet) rejenere olabilmiştir. Bu izolatlar CaCO3 içeren MRS agar besi yerinde inkübe edilmiş ve toplam organik asit üretimleri belirlenmiştir. Toplam asit üretimi yüksek olan 70 adet izolat MRS broth besi yerinde inkübe edilerek, laktik asit üretimleri belirlenmiştir. Bu izolatlar içerisinden laktik asit üretimi yüksek olduğu tespit edilen 10 adet izolat seçilmiştir. Seçilen 10 adet izolatın BIOLOG cihazında inkübasyon süresi boyunca farklı karbonhidrat kaynaklarını kullanma esasına göre tanımlaması yapılmıştır. Anahtar sözcükler: İzolasyon, LAB, Silaj, Tanımlama, Fermentasyon Ürünleri INTODUCTION competition between LAB and other microorganism groups [2]. Enough LA production decreases proteolysis and The objective of preserving forage resources is to even can completely stop when pH level comes to below ensure continuous regular feed for livestock in order to get a level of 4 [3]. LAB inoculation has been using widely in sustainable growth, fattening or milk production when recent years instead of inorganic acid or other applications market prices of forages are highest for the dry season in order to achieve a rapid LA fermentation in silage [4-6]. or for winter. One of the most important issues of quality silage making is to achieve a rapid drop of pH to a level of Due to microbial inoculation in silage making is not a 4.2 in anaerobic phase of silage. Dropping in pH is closely widely used practice, some problems such as insufficient related to lactic acid (LA) production level. The main factors LA fermentation, bad aerobic stability and bad smell of affecting LA production level and speed are epiphytic lactic silage are often occurred. Especially silage from legumes acid bacteria (LAB) on forage and chemical composition such as alfalfa, silage quality problems are getting bigger of crop material [1]. Silage quality is largely depends on because of high buffering capacity, low pH level and  İletişim (Correspondence)  +90 344 2802155  mkizil@ksu.edu.tr 292 Isolation and Identification ... relatively high proteolysis level. Isolation of LAB from by subtraction the area of inner circle from the outer one. rangeland and forage crops flora of some part of Turkey, The colonies, which have bigger acid production area, selecting isolates in terms of their LA production ability were considered as they have higher acid production and identification of selected stains were main aim ability. According to their acid production area and to of this study. rate of acid production area to colony area, 70 isolates in total were selected for the further studies and they MATERIAL and METHODS were identified as morphologically, physiologically and biochemically. 57 of total 70 isolates which have highest LAB Isolation Land and Plant Material acid production area (>150 mm 2) were selected directly. 13 of total isolates which have small both colony and acid Sample collecting for LAB isolation areas were 14 points production circle diameters but acid production circle is in Osmaniye, 14 points in Kahramanmaras, 12 points in big enough compare to its colony diameter area were also Goksun, 6 points in Afsin and 2 points in Elbistan, making selected in order to eliminate r2 factor when calculating 48 points in total. Elevation of sample points were ranging the area of circles. Directly the rate of two circle diameters from 39 m to 1516 m and samples were taken in different was taken into consider when selecting 13 isolates. dates in order to extend isolated strain’s diversity. Isolations were made not only from the fresh forage, but also from Identification of Selected 70 Isolates the silage made from the crops in sample points in order Selected 70 LAB isolates in total were identified to increase possibility of successive strains. Approximately morphologically (colony morphology), physiologically 500 g fresh forage was taken in all sample collecting point (catalase test) and cultural (gram reaction) then they were and immediately rinsed in ringer’s solution in order to identified biochemically by using BIOLOG identifying keep bacteria alive until they were incubated in MRS in system. laboratory. An extra 500 g of forage sample was collected and made silage with a portable vacuum machine and Determination of LA Production Ability of Selected these silages were used for further LAB isolation from LAB Isolates silage. Total sample replications were 347 of which 211 were from green forage while 136 from the silage made All isolates were grown in MRS broth media for of forages in sample points. The coordinates of the sample one night at 32°C then their bacterial densities were points were recorded but not given in this paper. determined in spectrophotometer at 600 nm. All isolates were re-incubated for one night more in MRS broth after LAB Isolation concentrations of all strains in per volume of MRS broth were equalized in order force all strains to produce LA under Dilution series were prepared from all green forage the same conditions. Bacteria were separated through and silage sample replications in order to count microflora filter and extract containing bacterial fermentation’s end (LAB, enterobacteria, yeast and moulds) and LAB isolation. products were run at HPLC with two parallels to determine LAB isolations were made from the colonies which are organic acids produced by LAB isolates. 10 LAB isolates grown decently and well-grown ones in the petri plates. were selected from 70 isolates considering amount of LA Then isolates were grown in a MRS agar media to get they produced. Selected high LA producer LAB strains pure isolates. Once pure isolates were gotten, they were were morphologically and physiologically examined as kept at -80°C with glycerin (15%) for the further studies. well as they identified by using BIOLOG (BIOLOG, Inc., In this study, 695 isolates in total were obtained but Hayward, CA, USA) [7] device. 531 of the total isolates could be regenerated from the keeping conditions. Researches were done on these 531 regenerated isolates. RESULTS Determination of Total Organic Acid Production of Isolation of LAB Isolated LABs Enterobacteria, yeast and mold counts were at high Isolates that could be regenerated from the keeping concentration as much as Log10 >7 cfu/g due to high conditions were firstly grown in 1 g/l CaCO3 containing MRS contamination at both green and silage samples taken media in order to determine total organic acid production from the areas on which livestock was grazed in the ability of individual isolates. After the incubation period, contrast enterobacteria, yeast and mold counts were as the colonies formed two circles, one with another. low as Log10 <2 cfu/g in the samples taken from forage Saturated colored inner circle expresses the colony size land and other marginal land at which animal were not while light colored or transparent outer circle expresses the grazed. LAB counts in MRS agar plate were between Log10 = area of total organic acid produced by colony. Both circle 3 and Log10 = cfu/g in green forage or silage samples. diameters were measured by a compass and circle areas LAB counts in samples taken on early spring were lower, were calculated. Net acid production area was calculated sometimes less than Log10 = 2, than the samples taken in 293 KIZILŞİMŞEK, KÜSEK GEZGİNÇ, EROL summer time. It has been observed that epiphytic LAB Identification probabilities of 33 isolates were higher concentration on green forage crops and silages increased than 70% and that of 22 isolates were between 50% and (10-4-10-5 for green crops and 10-8 for silage samples) 70%. Only 15 isolates were identified with a similarity while enterobacteria, yeast and mold counts decreased rates (probability) which are less than 50%. So, 55 of 70 as sampling season (shown as sample number in Table 1) isolates were assumed to be identified successfully. Genus changed into summer period (Table 1). distribution of 70 isolates according to BIOLOG system, were as follows: 43 isolates belong to Lactobacillus, 5 isolates Determination of Total Acid Production Ability of belong to Leuconostoc, 8 isolates belong to Enterococcus, LAB Isolates 3 isolates belong to Brothotrix, 5 isolates belong to Regenerated 531 LAB isolates from stock solution were Corynebacterium, 4 isolates belong to Streptococcus, 2 isolates point inoculated in MRS agar containing CaCO3 in order to belong to Weisella genus’s. determine how much the colonies produced total organic acids during the incubation period. The best organic acid Morphological and Biochemical Analyses of producer 70 isolates of all were selected. Selected 70 Isolates Identification of Selected 70 Isolates All selected isolates were found as catalase (-), oksidase (-) and gram (+) concurring with LAB bacteria characters Selected 70 isolates according to their higher total indicated by Hammes and Vogel [8]. Colony morphologies acid production ability were identified by BILOG system. of 36, 22, 9 and 3 isolates were determined as bacillus, Table 1. Mean microorganism numbers. pH in silages and DM contents Tablo 1. Silajda ortalama mikroorganizma sayıları. pH ve kuru madde içeriği Green Forage Silage Samples Green Forage Silage Samples 1 6.34 8.94 2.00 <2 6.78 3.70 5.2 15.26 25 5.95 7.88 <2 <2 5.00 5.70 5.47 21.53 2 5.48 8.72 <2 5.72 6.73 4.11 4.86 18.36 26 <2 7.38 <2 <2 6.08 6.11 4.49 23.06 3 5.88 8.66 <2 <2 6.71 3.08 5.12 14.18 27 <2 <2 9.59 <2 6.15 5.36 4.49 19.57 4 7.00 8.79 2.00 <2 6.28 3.45 4.94 21.95 28 <2 <2 9.59 <2 4.18 3.70 4.47 15.51 5 7.20 8.68 <2 <2 6.79 3.18 5.11 16.74 29 4.95 6.88 5.08 <2 4.52 5.94 5.39 24.96 6 6.61 8.53 <2 3.70 8.04 3.41 4.89 17.74 30 <2 <2 3.72 <2 6.15 5.45 5.44 36.76 7 6.28 7.67 2.11 3.51 5.45 7.34 5.28 13.91 31 <2 <2 6.11 2.00 6.99 7.04 5.42 26.55 8 7.15 8.00 2.18 <2 5.93 6.36 3.97 22.21 32 <2 <2 5.34 <2 5.91 6.15 5.45 31.28 9 6.93 8.36 <2 5.03 6.04 8.11 5.29 18.01 33 <2 <2 5.04 2.74 6.57 6.20 5.40 26.32 10 6.79 8.40 2.67 <2 6.00 6.28 3.59 19.82 34 <2 <2 4.23 <2 5.89 4.00 4.88 32.51 11 7.30 9.08 3.41 <2 6.41 7.30 5.28 16.44 35 5.74 <2 <2 <2 4.76 <2 4.64 25.97 12 6.94 8.67 2.54 <2 3.70 4.83 4.66 23.00 36 5.41 <2 3.51 2.60 6.91 6.60 5.51 26.81 13 6.66 8.95 3.45 <2 5.74 8.74 4.26 22.65 37 5.74 <2 4.89 2.18 5.67 5.97 5.50 31.32 14 6.18 7.76 3.18 <2 4.18 6.48 3.96 24.16 38 5.67 <2 4.49 3.30 5.48 5.53 5.23 27.90 15 5.40 8.30 2.30 <2 4.00 5.71 4.04 18.73 39 <2 <2 <2 4.18 5.59 4.70 4.99 29.22 16 6.94 7.72 5.53 <2 5.43 5.54 4.81 14.25 40 6.40 7.65 <2 5.89 5.08 5.43 5.50 34.32 17 7.75 8.60 4.94 <2 5.88 5.04 5.30 13.03 41 4.30 <2 4.56 2.85 5.38 5.61 5.56 14.94 18 7.20 7.81 5.15 3.70 6.64 6.70 4.21 27.16 42 4.48 7.60 6.63 2.60 5.81 5.26 5.49 18.15 19 6.81 6.94 5.40 <2 5.00 4.78 5.50 13.39 43 <2 5.70 3.75 <2 6.00 5.83 5.51 21.08 20 7.15 8.34 <2 <2 6.38 6.71 4.49 11.56 44 5.53 6.00 5.96 <2 5.48 5.51 5.02 16.92 21 6.89 7.53 5.60 3.70 7.46 7.46 4.43 21.44 45 6.18 6.93 6.08 <2 5.26 6.74 5.42 16.35 22 7.20 8.15 3.74 <2 4.70 <2 4.06 24.65 46 5.49 5.70 4.08 <2 5.63 4.45 5.49 17.13 23 6.62 7.46 4.40 <2 6.89 6.52 5.36 15.13 47 5.54 <2 3.63 2.90 6.18 6.48 5.48 13.50 24 <2 10.80 <2 <2 5.71 5.32 5.67 15.09 48 5.67 7.27 5.69 <2 6.20 5.00 5.48 15.96 Sample No Enterobacteria (Log10) Yeast (Log10) LA Bacteria (Log10) Enterobacteria (Log10) Yeast (Log10) LA Bacteria (Log10) pH DM (%) Sample No Enterobacteria (Log10) Yeast (Log10) LA Bacteria (Log10) Enterobacteria (Log10) Yeast (Log10) LA Bacteria (Log10) pH DM (%) 294 Isolation and Identification ... coccus, short bacillus and diplococcus, respectively. the most extended variation among the isolates was in terms of ethanol production ranging from 0 to 35.73 LA and Other Organic Acid Production of mmol/L. All isolates produced lower propionic acid (<0.2 Selected 70 LAB Isolates mmol/L) except for the isolate number 7 (BOLSON-2-3) whose production was 6.81 mmol/L. It has been found that all isolates have produced more or less LA changing from 18.69 mmol/L to 70.02 mmol/L. The best 10 isolates according to their LA production The highest LA production was obtained from number level among given in Table 2 is selected (Table 3) and used 2 (LS-55-2-2) while number 61 (LS-31-1-4) produced the as microbial inoculant for corn and alfalfa silages in order highest (7.78 mmol/L) acetic acid. It has been found that to determine their effects on fermentation profile in both Table 2. Fermentation product profile (mmol/l) and rate of LA in total fermentation product (%) Tablo 2. Fermentasyon ürün profile (mmol/l) ve toplam fermentasyon ürünü içinde laktik asit oranı (%) Fermentation End Products Fermentation End Products No No 1 L-42-8 0.00 43.62 0.74 0.10 0.00 98.10 36 L-50-8 0.00 31.67 1.74 0.05 0.00 94.66 2 LS-55-2-2 0.43 70.02 6.61 0.01 8.53 81.79 37 LS-30-1 0.09 30.78 9.98 0.01 35.73 40.19 3 L-60-5 0.00 50.16 0.58 0.12 0.84 97.02 38 L-34-1-2 0.00 27.78 9.71 0.02 32.02 39.95 4 L-38-2-2 0.20 43.34 2.20 0.06 4.30 86.50 39 LS-2-2 0.30 49.49 1.85 0.19 1.33 93.10 5 L-44-4-1 0.00 32.23 0.00 0.03 0.00 99.90 40 LS-6-5-1 0.27 29.94 2.51 0.04 7.16 74.98 6 L-70-10-1 0.02 28.56 1.88 0.02 0.38 92.57 41 LS-49-2-1 0.26 51.10 1.09 0.09 3.01 92.00 7 BOLSN-2-3 0.00 48.52 0.00 6.81 0.00 87.69 42 LS-72-2 0.02 54.00 1.64 0.10 1.72 93.94 8 L-61-3-2 0.03 48.03 0.88 0.07 1.40 95.27 43 LS-6-3 0.29 35.01 3.46 0.04 0.02 90.15 9 LS-51-2-1 0.27 53.85 1.71 0.11 1.20 94.24 44 LS-39-1-3 0.00 35.30 8.58 0.05 14.36 60.56 10 LS-71-2-3 0.04 52.39 1.54 0.08 0.00 96.93 45 L-58-6-2 0.00 30.37 1.29 0.08 3.07 87.24 11 L-57-2 0.02 51.15 2.20 0.11 3.20 90.24 46 L-54-10-1 0.00 48.39 0.54 0.06 0.00 98.77 12 L-68-1 0.06 44.42 4.61 0.11 18.97 65.17 47 L-61-8-2 0.06 48.95 1.94 0.04 0.00 96.00 13 L-55-2 0.00 28.13 0.93 0.03 0.00 96.70 48 L-57-4-2 0.00 51.85 1.85 0.14 0.00 96.31 14 LS-2-4-1 0.04 52.96 2.15 0.09 2.35 91.96 49 LS-43-2-3 0.25 48.71 1.40 0.13 3.49 90.23 15 LS-3-4-2 0.35 49.64 6.00 0.00 11.17 73.91 50 LS-4-4 0.16 37.47 0.61 0.06 2.27 92.37 16 L-70-6-1 0.06 53.47 4.24 0.06 0.60 91.51 51 L-61-5-1 0.00 20.83 4.45 0.04 21.14 44.83 17 LS-8-1 0.02 52.69 2.39 0.19 1.95 92.05 52 L-61-2-1 0.02 27.40 2.87 0.02 14.67 60.92 18 LS-65-2-1 0.30 56.65 1.69 0.15 1.07 94.66 53 L-61-6-1 0.01 22.52 2.41 0.03 11.66 61.49 19 L-70-7-1 0.00 18.69 5.62 0.00 15.04 47.49 54 L-53-8-2 0.02 47.40 0.00 0.05 1.18 97.43 20 L-5-9-1 0.08 49.59 2.95 0.16 1.86 90.77 55 L-38-4 0.00 51.84 3.72 0.01 4.78 85.89 21 LS-8-5-1 0.00 22.11 2.90 0.01 25.81 43.49 56 L-51-2-1 0.03 49.22 1.83 0.09 4.04 89.15 22 L-44-2 0.00 42.05 0.00 0.12 0.14 99.37 57 L-55-8-2 0.00 49.33 6.75 0.03 7.27 77.83 23 L-50-5-1 0.00 50.01 1.56 0.11 1.43 94.17 58 L-53-1-1 0.00 24.13 0.50 0.05 0.00 97.78 24 L-57-7 0.00 43.94 0.00 0.10 4.01 91.46 59 L-51-2-2 0.05 46.49 0.50 0.05 8.44 83.72 25 LS-9-3 0.00 25.30 2.06 0.10 4.41 79.39 60 L-54-4 0.00 27.60 7.44 0.04 32.18 41.03 26 LS-8-3 0.00 41.41 4.44 0.04 2.68 85.25 61 LS-31-1-4 0.28 59.08 7.78 0.04 2.22 85.12 27 L-35-1 0.24 35.30 2.18 0.01 0.06 93.39 62 L-58-6-1 0.00 44.55 0.16 0.07 1.85 95.56 28 L-70-5 0.00 51.57 7.17 0.02 5.28 80.53 63 L-60-7 0.06 44.19 1.86 0.01 1.54 92.71 29 L-57-2-1 0.00 30.65 0.97 0.11 0.00 96.60 64 L-61-7-2 0.03 51.42 1.28 0.09 3.61 91.13 30 LS-3-3 0.22 54.59 2.57 0.10 3.01 90.26 65 LS-69-1-2 0.18 30.34 9.81 0.03 15.25 54.57 31 P710-2 0.00 35.89 4.38 0.03 28.76 51.97 66 LS-40-1-2 0.22 32.49 4.80 0.03 23.51 53.21 32 LS-8-4-1 0.00 31.87 2.45 0.01 0.56 91.34 67 L-44-11 0.00 49.80 0.34 0.15 2.35 94.62 33 L-61-9-2 0.02 50.03 0.61 0.14 1.31 96.00 68 L-61-4-1 0.06 41.75 0.22 0.12 1.03 96.68 34 L-44-8-2 0.00 30.39 5.69 0.01 30.73 45.48 69 L-57-4-1 0.00 25.47 1.44 0.11 22.29 51.65 35 LS-3-2-1 0.00 30.08 0.72 0.05 0.00 97.52 70 L-41-1-1 0.01 49.39 0.70 0.09 0.00 98.40 Isolat Name Succinic Acid (mmol/L) Lactic Acid (mmol/L) Acetic Acid (mmol/L) Propionic Acid (mmol/L) Ethanol (mmol/L) LA Rate in Total Products (%) Isolat Name Succinic Acid (mmol/L) Lactic Acid (mmol/L) Acetic Acid (mmol/L) Propionic Acid (mmol/L) Ethanol (mmol/L) LA Rate inTotal Products (%) 295 KIZILŞİMŞEK, KÜSEK GEZGİNÇ, EROL Table 3. Species name. LA production (mmol/l) and LA rate in total fermentation products (%) and physiological characters of selected and transferred to further inoculation studies 10 isolates Tablo 3. İleriki inokulasyon çalışmalarında kullanmak üzereseçilen 10 adet izolatın tür ismi. LA üretimi (mmol/L). toplam fermentasyon ürününde LA oranı (%) ve fizyolojik karakterleri Isolate Isolate Species LA Production LA/Total Fermentation Physiological No Name (mmol/L) Products (%) Character 2 LS-55-2-2 Lactobacillus brevis 70.02 81.79 Heterofermentative 9 LS-51-2-1 Lactobacillus gasseri 53.85 94.24 Homofermentative 10 LS-71-2-3 Lactobacillus plantarum 52.39 96.93 Homofermentative 14 LS-2-4-1 Lactobacillus plantarum 52.96 91.96 Homofermentative 16 L-70-6-1 Leuconostoc citerum 53.47 91.51 Homofermentative 17 LS-8-1 Pediococcus citerum 52.69 92.05 Homofermentative 18 LS-65-2-1 Lactobacillus bifermentans 56.65 94.66 Homofermentative 30 LS-3-3 Lactobacillus plantarum 54.59 90.26 Homofermentative 42 LS-72-2 Lactobacillus plantarum 54.00 93.94 Homofermentative 61 LS-31-1-4 Lactobacillus buchneri 59.08 85.12 Heterofermentative cereal and legume silages (data not given). All selected as and kept in -80ºC but 531 of them can regenerate from the high LA producer isolates were belong to Lactobacillales stock solution when the time of use. Regenerated isolates family. 8, 1 and 1 of total 10 isolates scattered Lactobacillus, were grown at MRS media containing CaCO3 in order to Leuconostoc, and Pediococcus genus’, respectively. 4 isolates determine total organic acid production and 70 of them from Lactobacillus were belong to L .plantarum, and the were selected. others to L. brevis, L. gasseri, L. bifermentans and L. buchneri species with one each member. Among 10 selected strains, It is found that 43 of the selected 70 isolates were the LA production rate in total organic acid production of isolated from green forage samples while 27 of them were L. brevis ve L. buchneri species were found as 81.79% and from silage samples. This is because of there were much 85.12%, respectively. LA proportions in total organic acid more isolates from green forage sample replications than productions of all other isolates were higher than the the isolates from silage samples. Selected 70 isolates in critical level of 90.0% which is assumed as the lowest LA total were transferred to further research for determining production limit of homofermentative LAB fermentation. the fermentation profiles of isolates after they were Those two isolates which have lower LA proportion level identified by BIOLOG microbiological identification system. of 90% of total fermentation products were determined It is found that Lactobacillus was the most common genus as heterofermentative species while the others defined (61.4% of total LAB) on epiphytic flora on plant and, as a as homofermentative. Hommes and Hertel [9] stated at result, on silage environment. their Bacteriology book in which they explained widely the morphologic, physiologic and genetic characteristic This is an expectable situation to consider that the of LAB, L. brevis and L. buchneri species were stated most common LAB family found on crop’s epiphytic flora as facultative heterofermentative and they have very is Lactobacillales family as all selected isolates were a similar metabolic characters supporting accuracy of our member of a foresaid family. A great majority of selected identification results from the BIOLOG device. strains (9 in 10) were isolated from silage samples while only one isolate (L-70-6-1) was from green forage. This situation indicated that exploring chance of easily grown, DISCUSSIONS high competitive, high LA producer and tolerant to low pH level isolates was clearly increased by isolating directly It is well known that pH levels of silages made for from matured silages. getting LAB isolation were affected by crop factors such as DM content of raw material, growing sage of forage crops, Mainly two points from this research can be deduced botanical composition of forage, microbial factors such as follows; as epiphytic LAB and other microbial content of forage, 1- Preselection of isolates by using CaCO containing LAB strains effectiveness in silo, and other environmental 3 [10] media in order to determine their total fermentation acid factors such as silo conditions . pH level of all silages production is an appropriate method. were lower than 5.5 in general and very low pH level values of 3.8 were also reached in some silages. DM contents 2- Bacteria isolation for silage inoculation from matured of silages were varied from 11.56% to 34.32% (Table 1). silage has advantages compare to that of green forage due Incidentally LAB isolations were made in various numbers to the bacteria already grew in silage and competed to right after the plate counting then they were kept -80ºC for other microorganisms. Too many isolate from green forage further use. Total 695 isolates were taken from the plates is needed to get successive results. 296 Isolation and Identification ... REFERENCES interaction on silage fermentation and dairy production. J Dairy Sci. 75:764-773, 1992. DOI:10.3168/jds.S0022-0302(92)77814-X 1. Kizilsimsek M, Schmidtt RJ, Kung L Jr: Effects of a mixture of lactic 6. Pitt RE: The probability of inoculant effectiveness in alfalfa silages. acid bacteria applied as a freeze-dried or fresh culture on the fermentation ASAE, 33,1771-1778, 1990. DOI: 10.13031/2013.31538 of alfalfa silage. J Dairy Sci. 90, 5698-5705, 2007. DOI: 10.3168/jds. 7. Jones JB, Chase AR, Haris GK: Evaluation of the biolog GN microplate 2007-0448 system for identification of some plant pathogenic bacteria. Plant Disease, 2. Durmaz H, Avcı M, Aygün O: The precence of Listeria species in corn 77, 553-558, 1993. DOI: 10.1094/PD-77-0553 silage and raw milk produced in southeast region of Turkey. Kafkas Univ 8. Hammes WP, Vogel RF: The genus Lactobacillus. In, Wood BJB, Vet Fak Derg, 21, 41-44 2015. DOI: 10.9775/kvfd.2014.11664 Holzapfel WH (Eds): In the Genera of Lactic Acid Bacteria. 19-54, Chapman 3. Van Soest PJ, Robertson JD, Lewis BA: Methods for dietary fibre, & Hall, London, 1995. neutral detergent fibre and non-starch polysaccharides in relation to 9. Hammes WP, Hertel C: Genus Lactobacillus. In, De Vos P. Garrity animal nutrition. J Dairy Sci. 74, 3583-3597, 1991. DOI: 10.3168/jds.S0022- GM, Jones D, Krieg NR, Ludwig W, Rainey FA, Schleifer KH, Whitman 0302(91)78551-2 WB: Bergey’s Manual of Systematic Bacteriology. 2nd ed., 465-511, Springer, 4. Kung L Jr, Tung S, Maciorowski KG, Buffum K, Knutsen K, Aimutus NewYork, USA, 2009. WR: Effect of plant cell wall degrading enzymes and lactic acid bacteria 10. Pahlow G, Muck RE, Driehuis F, Oude Elferink SJW, Spoelstra A: on silage fermentation and composition. J Dairy Sci, 74, 4284-4296, 1991. Microbiology of ensiling. In, Buxon DR, Muck RE, Harrison JH (Eds): Silage DOI: 10.3168/jds.S0022-0302(91)78623-2 Science and Technology. 31-93, ISBN: 0-89118-151-2, Springer, NewYork, 5. Stokes M R: Effects of an enzymes mixture, an inoculant and their USA, 2003. Kafkas Univ Vet Fak Derg KafKas Universitesi veteriner faKUltesi Dergisi 22 (2): 297-300, 2016 JoUrnal Home-Page: http://vetdergi.kafkas.edu.tr Short Communication DOI: 10.9775/kvfd.2015.14371 online sUbmission: http://vetdergikafkas.org Serum IL-1β, IL-6, IL-10 and TNF-α Levels in Thyroidectomized Rats [1] Sinan KANDIR 1 Ercan KESKİN 1 [1] This project was partially supported by The Scientific and Technological Research Council of Turkey (TUBITAK)/ARDEB 1002 Short Term R&D Funding Program (Project No:115O130) 1 Department of Physiology, Faculty of Veterinary Medicine, Selcuk University, TR-42250 Konya - TURKEY Article Code: KVFD-2015-14371 Received: 11.09.2015 Accepted: 01.12.2015 Published Online: 01.12.2015 Abstract This study was conducted to determine the serum levels of interleukin (IL)-1β, IL-6, IL-10 and tumor necrosis factor alpha (TNF-α) in thyroidectomized rats. Hypothyroidism was performed by surgical thyroidectomy in rats. Four weeks after from surgical procedure, selected cytokines levels were evaluated. Hypothyroidism was confirmed by elevated thyroid stimulating hormone (TSH) and decreased free tri-iodothyronine (fT3) levels (P<0.05) in thyroidectomized group. Serum IL-1β, IL-6, IL-10 levels have shown slight increase, whereas only TNF-α level (P<0.05) were significant statistically in thyroidectomized rats compared with control group. In conclusion, the obtained data suggest that elevated levels of cytokines could be as a consequence of thyroidectomy operation. Keywords: Cytokine, Immune function, Rodent, Thyroid alteration, Trauma Tiroidektomize Ratlarda Serum IL-1β, IL-6, IL-10 ve TNF-α Seviyeleri Özet Bu çalışmada, tiroidektomize ratların serum interlökin (IL)-1β, IL-6, IL-10 and TNF-α düzeylerinin belirlenmesi amaçlanmıştır. Hipotiroidizm cerrahi yolla tiroidektomi yapılarak gerçekleştirildi. Cerrahi işlemden sonraki 4. haftada, seçili sitokinlerin seviyeleri ölçüldü. Hipotiroidizm, tiroidektomize grubun tiroid uyarıcı hormon (TSH) düzeyindeki artış (P<0.05) ve serbest tri-iyodotironin (fT3) düzeyindeki azalış (P<0.05) ile teyit edildi. Tiroidektomize ratların serum IL-1β, IL-6, IL-10 seviyelerinin kontrol grubuna kıyasla hafif düzeyde yükseldiği ancak, sadece TNF-α düzeyindeki artışın istatistiki olarak anlamlı (P<0.05) olduğu görüldü. Sonuç olarak elde edilen veriler, sitokin seviyelerindeki yükselmenin, tiroidektomi operasyonunun bir sonucu olabileceğini düşündürmektedir. Anahtar sözcükler: İmmun fonksiyon, Rodent, Sitokin, Tiroid bozulması, Travma INTRODUCTION IL-1 type I receptor (IL-1RI) and IL-1RII due to exert similar biological effects act as proinflommatory cytokine which Cytokines are a heterogeneous group of polypeptides has potentiating immune and inflammatory responses which have multifunctional act as modulating, triggering Multifunctional, pleiotropic cytokine IL-6 is regulated of and regulating of inflammatory and immune responses. immune and acute-phase responses, hematopoiesis and Most cytokines have autocrine and paracrine effects owing inflammation which is produced by innate immune cells (T to multiple cellular sources. Interleukins are described as helper 2; Th2), monocytes and macrophages, endothelial any of various compounds of low molecular weight (~17 to cells, fibroblasts, that promotes T-cell proliferation, B-cell 60 kd) these are produced by lymphocytes, macrophages differentiation and survival triggering by IL-1 and tumor and monocytes and they act as regulate of the humoral and necrosis factor alpha (TNF-α). When firstly described in innate immune functions and inflammation cascades [1]. late of the 80’s an anti-inflammatory cytokine IL-10 was known as cytokine synthesis inhibiting factor. Whilst the The firstly discovered interleukin was IL-1 which has major source of this cytokine is macrophages, Th2 cells, extensive family consisted by 11 members. The major monocytes and keratinocytes may also produce. Another members of IL-1 family are IL-1α and IL-1β, these two proteins pro-inflammatory cytokine tumor necrosis factor alpha are binding to the same receptor complexes namely as (TNF-α) is in a relationship with the physiopathologies  İletişim (Correspondence)  +90 332 2232632  skandir@selcuk.edu.tr 298 Serum IL-1β, IL-6, IL-10 ... of cancer, neurological, cardiovascular, autoimmune and thyroidectomy operation blood samples were taken by metabolic disorders through activation of nuclear factor cardiac puncture under deeply anesthetized with ketamine kappa B (NF-κB) pathway [2,3]. HCl and xylazine HCl collected into non-coagulant tubes and centrifuged (3.000 x g for 5 min) after that collected Thyroid hormones are affected nearly all metabolic sera was stored -80°C until analysis. processes by using different pathways. Hypothyroidism have described as absence or lacking of thyroid hormones Assessment of Thyroid Hormones and Cytokines which could cause of abnormalities on metabolic and immunological functions. Cytokines play pivotal role in Serum concentrations of thyroid stimulation hormone autoimmune thyroid disorders namely as Graves’ disease or (TSH) and free tri-iodothyronine (fT3) were determined Hashimoto’s thyroiditis [4]. Various models have been widely by autoanalyser (ADVIA Centaur XP Immunoassay System, used as congenital hypothyroid animals due to thyroid Siemens, USA) and selected cytokines IL-1β (Cat. No. gland dysgenesis or thyroid dyshormonogenesis, thyroid BMS630), IL-6 (Cat. No. BMS625) and IL-10 (Cat. No. BMS629) hormone receptor (TR) gene mutated animals, and thyroid and TNF-α (Cat. No. BMS622) were determined by ELISA hormone transport or metabolism modified animals for (Bio-tek Instruments, Inc.) using sandwich enzyme-linked enhancing knowledge and clarify the thyroid hormone immunosorbent method according to manufacturer’s action [5]. In order to realize adult-onset hypothyroidism (Ebioscience) instructions. in rodents, thiourea based selenium analogue antithyroid agents have been used in such as propylthiouracil (PTU) Statistical Analysis or methimazole (MMI). Nevertheless, previously studies Statistical analysis was performed with the SPSS 19.0 revealed that PTU and MMI have immunomodulatory package program for Windows (SPSS, Inc., Chicago, IL, effects [6]. USA). Data are expressed as mean ± standard error of the Therefore, hypothyroidism was induced by thyro- mean (SEM) Student’s t-test was used for determination idectomy operation due to withdrawn adverse effects of among the groups. P<0.05 was considered for statistically antithyroid drugs on immune system function and it was significant. aimed to determine the serum levels of IL-1, -6, -10 and TNF-α in adult-onset hypothyroidism. RESULTS MATERIAL and METHODS As shown as Table 1, hypothyroidism was confirmed by elevated TSH and decreased fT3 levels (P<0.05) in Animals thyroidectomized group. Ten male Wistar rats (12 weeks age) obtained from According to obtained data IL-1β, IL-6 and IL-10 Selcuk University Experimental Medicine Research and levels (Table 2) were slightly increased but these were Application Center. Rats were kept in a room at a constant not statistically significance except TNF-α level in thyro- temperature 22±2°C with 50% relative humidity, 12 h idectomized animals compared with control group (P<0.05). light/dark cycle period and housed in polycarbonate cages with fed by standart rat chow and tap water ad libitum. All Tablo 1. Tiroid hormon düzeyleri (mean±SEM, n=5) experimental procedure was approved by Selcuk University Table 1. Thyroid hormone levels (mean±SEM, n=5) Experimental Medicine Research and Application Center Group TSH µIU/mL fT3 ng/dL Local Ethics Committee (Approval number: 2014/16). Control 1.73±0.29 b 3.36±0.27 a Experimental Protocol Tx 19.54±1.61 a 2.03±0.32 b a,b Different letters in the same column refers the differences between the Rats were randomly divided into two groups as control groups (P<0.05) (n=5) and thyroidectomized (Tx, n=5). Hypothyroidism was generated by surgical thyroidectomy in rats with anesthetized by xylazine HCl (10 mg/kg/BW) and ketamine DISCUSSION HCl (50 mg/kg/BW). Briefly, using a stereomicroscope (Olympus Co.,Tokyo, Japan) for better observation, the Hypothyroidism could cause of reduction in serum pro- stenothyroid muscle was cut and the trachea was exposed. inflammatory cytokines IL-6 and TNF-α levels in mice [7], rats [8], The parathyroid gland was found, dissected from the which were induced by PTU, MMI and thyroidectomy. thyroid gland, and implanted into the surrounding neck Also, Kızıltunc et al.[9] reported that IL-6 and TNF-α serum muscle. The thyroid gland was completely excised. After levels were decreased in humans who suffered owing surgery, carprofen (Rimadyl© Pfizer, 5 mg/kg) was injected to hypothyroidism. Contrarily to these data, PTU did not over 3 days to alleviate pain. The control group received cause any alteration in circulating levels of TNF-α in human [10] the pre- and post-surgery treatment. Four weeks after nor in rats [11]. 299 KANDIR, KESKİN Tablo 2. Serum sitokin seviyeleri (mean±SEM, n=5) Table 2. Serum cytokine levels (mean±SEM, n=5) Group IL-1β (pg/mL) IL-6 (pg/mL) IL-10 (pg/mL) TNF-α (pg/mL) Control 28.02±2.39 30.20±2.35 36.51±1.63 39.61±2.09 b Tx 39.05±5.49 36.04±3.73 38.93±1.85 46.23±1.01 a a, b Different letters in the same column refers the differences between the groups (P<0.05) In this regard, we have investigated the serum levels a model in experimental studies, these data have to take of IL-1, -6, -10 and TNF-α in thyroidectomized rats. In the into consideration. present study, serum TSH levels approximately ~11 fold higher (P<0.05) and fT3 levels decreased (P<0.05) in REFERENCES the thyroidectomized group compared with control. The obtained data shown that hypothyroidism have been well 1. Ajjan RA, Watson PF, Weetman AP: Cytokines and thyroid function. established after thyroidectomy operation. Adv Neuroimmunol, 6, 359-386, 1996. DOI: 10.1016/S0960-5428(97)00027-7 2. Aggarwal BB, Gupta SC, Kim JH: Historical perspectives on tumor IL-1 inhibits TSH-induced TPO gene expression directly, necrosis factor and its superfamily: 25 years later, a golden journey. Blood, thus IL-1 as a local inhibitor of THs synthesis. Additionally, 119, 651-665, 2012. DOI: 10.1182/blood-2011-04-325225 IL-6 can inhibits TSH-induced TPO mRNA transcription in 3. Akdis M, Burgler S, Crameri R, Eiwegger T, Fujita H, Gomez E, Klunker S, Meyer N, O’Mahony L, Palomares O,   Rhyner C,  Ouaked a dose-dependent manner [1]. N, Schaffartzik A, Van De Veen W, Zeller S, Zimmermann M, Akdis CA: Interleukins, from 1 to 37, and interferon-gamma: receptors, functions, Pro-inflammatory or anti-inflammatory cytokines which and roles in diseases. J Allergy Clin Immunol, 127, 701-721 e701-770, 2011. produced by Th1 (IL-1β, TNF-α) and Th2 (IL-6, IL-10) cells DOI: 10.1016/j.jaci.2010.11.050 have crucial role in protecting against the autoimmune 4. Mikos H, Mikos M, Obara-Moszynska M, Niedziela M: The role of thyroid disease [4,12]. Furthermore, now it is well known that the immune system and cytokines involved in the pathogenesis of IL-1, IL-6 and TNF-α could play central role in the patho- autoimmune thyroid disease (AITD). Endokrynol Pol, 65, 150-155, 2014. DOI: 10.5603/EP.2014.0021 genesis of non thyroidal illness (NTI) syndrome by acting [13] 5. Koibuchi N: Animal models to study thyroid hormone action in on hypothalamus pituitary-thyroid axis . IL-1, IL-6 and TNF-α cerebellum. Cerebellum, 8, 89-97, 2009. DOI: 10.1007/s12311-008-0089-x are effect as suppressor mediators on thyroid hormones 6. Volpe R: The immunomodulatory effects of anti-thyroid drugs are during NTI [14]. Also, Bartalena et al.[15] tested that hypothesis mediated via actions on thyroid cells, affecting thyrocyte-immunocyte in rats with induced hypothyroidism by administration of signalling: a review. Curr Pharm Des, 7, 451-460, 2001. DOI: 10.2174/ the methimazole throughout 3 weeks and they concluded 1381612013397898 that 48 hours after a single dose recombinant human IL-6 7. Shirin H, Dotan I, Papa M, Maaravi Y, Aeed H, Zaidel L, Matas Z, Bruck injection could reduce serum T3, T4 and TSH concentrations R, Moss SF, Halpern Z, Oren R: Inhibition of concanavalin A-induced acute T cell dependent hepatic damage in mice by hypothyroidism. Liver, due to central effects of the cytokine. 19, 206-211, 1999. DOI: 10.1111/j.1478-3231.1999.tb00037.x From another aspect, trauma and wound healing could 8. Bruck R, Oren R, Shirin H, Aeed H, Papa M, Matas Z, Zaidel L, Avni Y, Halpern Z: Hypothyroidism minimizes liver damage and improves lead to significant elevation in pro-and anti-inflammatory survival in rats with thioacetamide induced fulminant hepatic failure. cytokines [16,17]. Especially IL-1β and TNF-α, IL-6 and Hepatology, 27, 1013-1020, 1998. DOI: 10.1002/hep.510270417 C-reactive protein, which is a predictor for acute-phase 9. Kızıltunc A, Basoglu M, Avcı B, Capoglu I: Serum IL-6 and TNF-α in response and IL-10 have been used in biomarkers for patients with thyroid disorders. Turk J Med Sci, 29 (1): 25-30, 1999. monitoring traumatic inflammation and recovery period 10. Elias AN, Nanda VS, Pandian R: Serum TNF-alpha in psoriasis in clinically both human and veterinary medicine [18-20]. after treatment with propylthiouracil, an antithyroid thioureylene. BMC Ozcinar et al.[21] reported the pro-inflammatory cytokines Dermatol, 30, 4, 2004. DOI: 10.1186/1471-5945-4-4 IL-1β and TNF-α levels were higher after thyroid surgery 11. Sener G, Sehirli O, Velioglu-Ogunc A, Ercan F, Erkanli G, Gedik N, Yegen BC: Propylthiouracil (PTU)-induced hypothyroidism alleviates in human. However, the sample size restricted to interpret burn-induced multiple organ injury. Burns, 32, 728-736, 2006. DOI: of the obtained data in the present study. Slight increased 10.1016/j.burns.2006.01.002 levels of pro-inflammatory cytokines IL-1, IL-6 due to 12. Sahna KC, Risvanli A: Th1/Th2 cytokine balance and SOCS3 levels their stimulator effects on TNF-α production raised the of female offspring born from rats with gestational diabetes mellitus. level significantly, meanwhile slight elevation on the level Kafkas Univ Vet Fak Derg, 21, 837-840, 2015. DOI: 10.9775/kvfd.2015.13723 of anti-inflammatory cytokine IL-10 might explain as a 13. de Vries EM, Fliers E, Boelen A: The molecular basis of the non- consequence of the thyroidectomy operation in accordance thyroidal illness syndrome. J Endocrinol, 225(3):R67-81, 2015. DOI: 10.1530/JOE-15-0133 with previous studies [19,21]. 14. van Haasteren GA, van der Meer MJ, Hermus AR, Linkels E, In conclusion, surgical thyroidectomy intervention may Klootwijk W, Kaptein E, van Toor H, Sweep CG, Visser TJ, de Greef WJ: Different effects of continuous infusion of interleukin-1 and interleukin-6 cause of alteration in levels of cytokines on post-operative on the hypothalamic-hypophysial-thyroid axis. Endocrinology, 135, 1336- period. Therefore, whilst used in hypothyroid animals as 1345, 1994. DOI: 10.1210/endo.135.4.7925094 300 Serum IL-1β, IL-6, IL-10 ... 15. Bartalena L, Grasso L, Brogioni S, Martino E: Interleukin 6 effects Wallingford: CAB International, 1997. on the pituitary-thyroid axis in the rat. Eur J Endocrinol, 131, 302-306, 19. Reikeras O, Borgen P, Reseland JE, Lyngstadaas SP: Changes in 1994. DOI: 10.1530/eje.0.1310302 serum cytokines in response to musculoskeletal surgical trauma. BMC Res 16. Uluisik D, Keskin E: The effects of ginseng and echinacea on some Notes, 7, 128, 2014. DOI: 10.1186/1756-0500-7-128 plasma cytokine levels in rats. Kafkas Univ Vet Fak Derg, 18, 65-68, 2012. 20. Ok M, Er C, Yildiz R, Col R, Aydogdu U, Sen İ, Guzelbektes H: DOI: 10.9775/kvfd.2011.4814 Evaluation of acute phase proteins, some cytokines and hemostatic 17. Hismiogullari SE, Hismiogullari AA, Yavuz MT, Yavuz O, Yaman parameters in dogs with sepsis. Kafkas Univ Vet Fak Derg, 21, 761-766, I, Seyrek K, Hayirli A, Rahman K: The protective effect of resveratrol 2015. DOI: 10.9775/kvfd.2015.13418 in experimentally induced non-sterile clean wound inflammation in 21. Ozcinar B, Aksakal N, Yanar F, Agcaoglu O, Peker KD, Turkoglu rats. Kafkas Univ Vet Fak Derg, 19 (Suppl.-A): A1-A5, 2013. DOI: 10.9775/ U, Mercan S, Ozarmagan S, Erbil Y: Increased interleukin 1 and tumor kvfd.2012.6989 necrosis factor alpha levels after thyroid surgery. Ulus Cerrahi Derg, 30, 18. Schijns VECJ, Horzinek MC: Cytokines in veterinary medicine. 80-84, 2014. DOI: 10.5152/UCD.2014.2484 Kafkas Univ Vet Fak Derg KafKas Universitesi veteriner faKUltesi Dergisi 22 (2): 301-304, 2016 JoUrnal Home-Page: http://vetdergi.kafkas.edu.tr Short Communication DOI: 10.9775/kvfd.2015.14406 online sUbmission: http://vetdergikafkas.org A Survey of Crimean-Congo Hemorrhagic Fever in Livestock in Republic of Kosova Kurtesh SHERIFI 1 ∆ Agim REXHEPI 1 ∆ Avni ROBAJ 1 Afrim HAMIDI 1 Behlul BEHLULI 1 Arben MUSLIU 1 Petra EMMERICH 2 ∆ These authors contributed equally to this work 1 Faculty of Agricultural and Veterinary Medicine, University of “Hasan Prishtina”, Str. “Bill Clinton”, n.n. 10000 Prishtina, KOSOVO 2 Bernhard-Nocht Institute, Department of Virology, Bernhard-Nocht Str. 74 D-20359 Hamburg, GERMANY Article Code: KVFD-2015-14406 Received: 17.09.2015 Accepted: 02.12.2015 Published Online: 04.12.2015 Abstract Crimean-Congo hemorrhagic fever (CCHF) is endemic in Kosova. The aim of our study was to detect the IgG and IgM antibodies to CCHF virus in cattle and sheep in endemic and non-endemic areas of Kosova. In total sera of 172 cattle and 95 sheep were tested by the Indirect Immunofluorescence Assay (IIA) for quantitative determination of antibodies to CCHF virus. Seven of 172 cattle sera (4.07%) and three of 95 sheep sera (3.16%) tested positive for IgG, but IgM were detected in the serum of only one sheep. The results of this study confirmed the fact that CCHF is endemic in four municipalities of Kosova and that there is a risk of the spread of viruses to other non-endemic regions through the movement of infected animals. Keywords: Crimean - Congo hemorrhagic fever virus (CCHFV), Cattle, Sheep, IgG, IgM Kosova Cumhuriyeti’nde Kırım Kongo Kanamalı Ateşi Üzerine Çiftlik Hayvanlarında Bir Araştırma Özet Kırım Kongo Kanamalı Ateşi (KKKA) Kosova’da endemiktir. Bu çalışmanın amacı endemik ve endemik olmayan Kosova bölgelerinde sığır ve koyunlarda KKKA virusuna karşı IgG ve IgM antikorlarını belirlemektir. Toplam 172 sığır ve 95 koyun İndirek İmmunoflorasan Tekniği ile KKKA virusuna karşı antikorların kantitatif tespiti amacıyla kullanılmıştır. 172 sığırın 70’i (%4.07) ve 95 koyunun 3’ü (%3.16) IgG pozitif olarak tespit edilirken IgM sadece 1 koyun serumunda belirlenmiştir. Bu çalışmanın sonuçları Kosova’nın 4 belediyesinde KKKA’nın endemik olduğunu doğrulamış ve enfekte hayvanların taşınması ile endemik olmayan bölgelere yayılım riskinin bulunduğunu göstermiştir. Anahtar sözcükler: Kırım Kongo kanamalı ateşi virusu (KKKAV), Sığır, Koyun, IgG, IgM INTRODUCTION to be the most important transmitters and source of the virus, determining distribution worldwide |2-5|. A wide The causative agent of CCHF is a member of the variety of domestic animals and birds (cattle, sheep, goats Bunyaviridae family, genus Nairovirus. The disease is and ostriches), as well as small wild mammals (hares and transmitted to humans through tick bites, by crushing hedgehogs) can become infected with the virus, and these infected ticks or by nosocomial contact with blood of infections are usually asymptomatic and subclinical |6,7|. infected animals or humans. Humans are the only known Livestock and other hosts can transmit CCHFV to humans hosts of CCHF virus: the disease is manifested as an acute during the viremic period |6|. febrile illness followed by hemorrhagic syndrome with CCHF is endemic in some parts of Europe, Asia and mortality rates of up to 50% |1|. The humans at greatest risk Africa. In recent years, cases of human infection have of infection are agricultural workers, veterinarians, abattoir increased, and have been reported from different countries. workers, and other persons in close contact with animals The disease has emerged or re-emerged in Turkey, Kosova, and ticks |2|. The circulation of the virus in nature is enzootic, Bulgaria, Albania and Greece. This has been attributed to tick - vertebrate - tick, and Hyalomma ticks are considered mild winters and to the disruption of agricultural activities,  İletişim (Correspondence)  +381 38 603 668  arben.musliu@uni-pr.edu 302 A Survey of Crimean-Congo ... both accounting for an increased tick population, as well including four municipalities (Prishtina, Gjilan, Mitrovice as to the migration or transportation of tick-infested birds and Peja). Sera were collected in the summer of 2008 or animals |8,9|. from 267 domestic animals, 172 from cattle and 95 from sheep. Identification of the specimens included location, Outbreaks of CCHF in Kosova usually occur in spring ownership and date of collection. Animals registered and summer with a reported human fatality rate up to in the system of the identification unit at Kosova Food 25.5% |10|. In 2010, 2265 patients were reported to have and Veterinary Agency were checked in 2014 for their tick bites, with 141 suspected cases of CCHF, 29 cases were movements around Kosova in the years 2010-2014. Sera confirmed using the PCR technique, and among these, were tested using the IIA for quantitative determination there were 8 deaths. Approximately the same number of IgG and IgM antibodies to CCHF virus in the Institute of of persons with tick bites and infected patients were Tropical Medicine “Bernhard Nocht”, Hamburg, Germany. reported in 2013 (Report of National Institute of Public IgG and IgM antibodies to CCHF virus were detected Health in Kosova, 2013). CCHF in Kosova is present in 50% using acetone-fixed Vero cells infected with CCHF virus of the territory with common characteristics of altitude, (strain ArD39554, GenBank accession number DQ211641). climate, low bush, fragmented agricultural land and the Cultivation of the virus was carried out in a BSL 4 laboratory. presence of the Hyalomma tick. Hyper-endemic zones are Serum samples were tested in twofold steps starting at a in the central and south west of Kosova: Malisheve, Kline, dilution of 1:40. Cell smears were routinely counterstained Rahovec and Suhareke. Hyalomma marginatum dominates with anti-CCHF nucleocapsid monoclonal antibody A4 |12| in the endemic municipalities, with 90.2% versus 24.3% using Rhodamine-anti-mouse as a secondary antibody |2|. in the non-endemic regions. 3.6% of ticks tested positive A chi-square test was used to determine the presence of with CCHFV by RT-PCR |11|. In 2012 a sero-prevalence of the antibodies in cattle and sheep and to establish whether healthy human population was 4.0% (range 0-9.3%) and in there was a significant difference between endemic and cattle 18.4%, mostly in endemic areas of Kosova |10|. non-endemic regions. The aim of this study was to detect the IgG and IgM antibodies to CCHF virus in cattle and sheep and to monitor RESULTS the movement of sero-positive animals from endemic to non-endemic regions in the Republic of Kosova. The study has shown that 10 from 267 tested animals (3.75%) tested positive for the presence of IgG and IgM antibodies to CCHFV. Seven of 172 (4.07%) cattle and three MATERIAL and METHODS of 95 (3.16%) sheep sera tested positive. Nine animals were positive for IgG antibody to CCHF virus, the serum Kosova is located in the Balkans in Southeastern Europe, of only one sheep tested positive for IgM. The region is a with continental and Mediterranean climates. It has a factor that influences the presence of antibodies in cattle land area totaling 10,908 km2 and a human population of and sheep. In endemic regions, 6.67% tested positive, as around 2 million (Agency of Statistics of the Republic of opposed to 0.76% in non-endemic regions. This difference Kosova, www.ask.rks-gov.net). Kosova has around 250.000 was statistically significant, χ2 (1) =6.464, P=0.011 (Table 1). cattle and 120.000 sheep (Kosova Food and Veterinary Agency). Nine samples from 135 tested animals or 90% of positive cases were detected in endemic regions (Prizren, The study was conducted in CCHF-endemic regions Suhareke, Rahovec and Malisheve). We estimated with that includes four municipalities in the central and 95% confidence that the proportion of ruminants in southwest parts of Kosova, namely Malisheve, Suhareke, endemic regions carrying the antibodies against CCHF in Prizren and Rahovec (Fig. 1), and in non-endemic regions sera was between 2.40% and 10.93%. One cattle serum of Fig 1. Map of Southeast Europe and Republic of Kosova - endemic regions of CCHF Şekil 1. Güneydoğu Avrupa ve Kosova Cumhuriyeti Haritası - KKKA endemik bölgeler 303 SHERIFI, REXHEPI, ROBAJ, HAMIDI BEHLULI, MUSLIU, EMMERICH Table 1. Sero-prevalence of antibodies to CCHF virus in cattle and sheep in Kosova Tablo 1. Kosova’da sığırlar ve koyunlarda KKKA virüsüne karşı antikor Sero-prevalansı Animals/Zone Nr. of IgG IgM % Positive Negative Negative 2 P Samples Positive Positive 95% CI Animals Animals (%) X Value Cattle 172 7 0 4.07 (1.09-7.05) 165 95.93 / / Sheep 95 2 1 3.16 (0.42-6.74) 92 96.84 / / Total 267 9 1 3.75 (1.45-6.04) 257 96.25 / / Endemic 135 8 1 6.67 (2.40-10.93) 126 93.33 6.464 0.011 Non endemic 132 1 0 0.76 (0.74-2.26) 131 99.24 / / Total 267 9 1 3.75 (1.45-6.04) 257 96.25 / / 132 tested animals tested positive from the non-endemic common practice to trade domestic animals in open region (Mitrovice). 29 of 267 (10.8%) tested animals were animal markets that are present in every municipality. moved from endemic to non-endemic regions, where In our study, 11% of animals tested from endemic regions there was one positive detection of IgG to CCHFV. had moved through trading in non-endemic regions and in one case we found one cow IgG seropositive for the DISCUSSION CCHF virus. In the study conducted by Sherifi et al.|11|, a tick with CCHF virus was found and removed from a cow which In Kosova there are no data about humans infected had been moved from an endemic municipality to a non- directly by contact with animals. 54% of the humans endemic municipality. This practice of trading and moving infected and diagnosed with CCHF have evidence of domestic animals with ticks infected with CCHF virus may being bitten by a tick, only 4% of patients were infected present a great risk for the spread of the CCHF virus to via contact from human to human and around 40% of other regions, where so far no reports of human infections infections are of unknown etiology |13|. The livestock have been received. husbandry in Kosovo is such that some households in rural The results of this study are important for the Kosova areas keep livestock for family needs, where they often national authorities that are responsible for controlling slaughter animals at home and may have direct contact and monitoring the CCHF in Kosova. To prevent the spread with the blood of infected animals. Even field veterinarians of the CCHF virus during spring and summer seasons from during meat inspection and treatment of animals can endemic municipalities to non-endemic municipalities, be infected through contact with the blood of infected it is important to treat domestic animals with Acaricides animals. A number of individuals became infected while prior to taking them to the animal market for trading. removing ticks by hand from animals and crushing them. According to the Clinical Center for Infectious Diseases, the Acnoweldgements largest number of patients with CCHF is to be found in the municipalites of Malisheve with 65%, Kline with 11.5% and The authors give special thanks to the collectors of Rahovec, Prizren and Suhareke with a total of 15%. This the blood samples, to the staff of the Bernhard-Nocht study has confirmed that the vast majority of sera-positive Institute, Department of Virology in Hamburg, Germany, animals are located in the endemic municipalities. This is in particular Corinna Thomé-Bolduan for enabling the an indication that the CCHF virus circulates in endemic detection of antibodies to CCHFV, and to all those who municipalities, with the highest prevalence of CCHF virus have contributed to this study. found in Hyalomma marginatum ticks in the municipalities of Malisheva (8.6%) and Klina (4%) |11|. The fact that the REFERENCES domestic animal population is kept partially in pasture 1. Swanepoel R, Shepherd AJ, Leman PA, Shepherd SP, McGillivray contributes to increase the tick population. Furthermore GM, Erasmus MJ, Searle LA, Gill DE: Epidemiologic and clinical features the fragmentation of agricultural land and the presence of Crimean-Congo hemorrhagic fever in southern Africa. Am J Trop Med of wild animals are playing an influential role in increasing Hyg, 36, 120-132, 1987. the tick population as they host the immature ticks (larvae 2. Ergönül O: Crimean-Congo hemorrhagic fever. Lancet Infect Dis, 6 (4): and nymphs) and act as a reservoir for the viruses. 203-214, 2006. DOI: 10.1016/S1473-3099(06)70435-2 3. Charrel RN, Attoui H, Butenko M, Clegg JC, Deubel V, Frolova T, There is a need for further studies in order to identify Gould EA, Gritsun TS, Heinz FX, Labuda M, Lashkevich VA, Loktev V, Lundkvist A, Lvov DV, Mandl CW, Niedrig M, Papa A, Petrov VS, which wild animals play an important role in hosting Plyusnin A, Randolph S, Süss J, Zlobin VI, de Lamballerie X: Tick-borne immature ticks Hyalomma marginatum in endemic regions virus diseases of human interest in Europe. Clin Microbiol Infect, 10, 1040- in Kosova. 1055, 2004. DOI: 10.1111/j.1469-0691.2004.01022.x 4. Fisher-Hoch SP: Lessons from nosocomial viral haemorrhagic fever It is important to note the fact that in Kosova it is a outbreaks. Br Med Bull, 73-74,123-137, 2005. DOI: 10.1093/bmb/ldh054 304 A Survey of Crimean-Congo ... 5. Whitehouse CA: Crimean-Congo hemorrhagic fever. Antiviral Res, 10. Fajs L, Jakupi X, Ahmeti S, Humolli I, Dedushaj I, Avšič-Županc 64, 145-160, 2004. DOI: 10.1016/j.antiviral.2004.08.001 T: Molecular epidemiology of Crimean-Congo hemorrhagic fever virus 6. Chinikar S, Ghiasi S, Hewson R, Moradi M, Haeri A: Crimean-Congo in Kosovo. PloS Negl Trop Dis, 8, e2647, 2014. DOI: 10.1371/journal. hemorrhagic fever in Iran and neighboring countries. J Clin Virol, 47, pntd.0002647 110-114, 2010. DOI: 10.1016/j.jcv.2009.10.014 11. Sherifi K, Cadar D, Muji S, Robaj A, Ahmeti S, Jakupi X, Emmerich P, Krüger A: Crimean-Congo hemorrhagic fever virus clades V and VI 7. Garcia S, Chinikar S, Coudrier D, Billecocq A, Hooshmand B, Crance (Europe 1 and 2) in ticks in Kosovo, 2012. PLoS Negl Trop Dis, 8, e3168, JM, Garin D, Bouloy M: Evaluation of a Crimean-Congo hemorrhagic 2014. DOI: 10.1371/journal.pntd.0003168 fever virus recombinant antigen expressed by Semliki Forest suicide virus for IgM and IgG antibody detection in human and animal sera collected 12. Emmerich P, Avšič-Županc T, Chinikar S, Saksida A, Thomé- in Iran. J Clin Virol, 35, 154-159, 2006. DOI: 10.1016/j.jcv.2005.02.016 Bolduan C, Parczany-Hartmann A, Langroudi AG, Moradi M, Ahmeti S, Günther S, Schmidt-Chanasit J: Early serodiagnosis of acute human 8. Leblebicioglu H: Crimean-Congo haemorrhagic fever in Eurasia. Int Crimean-Congo hemorrhagic fever virus infections by novel capture J Antimicrob Agents, 36 (Suppl-1): S43-S46, 2010. DOI: 10.1016/j. assays. J Clin Virol, 48, 294-295, 2010. DOI: 10.1016/j.jcv.2010.05.002 ijantimicag.2010.06.020 13. Ajazaj L, Ahmeti S, Halili B: Crimean-Congo hemorrhagic fever 9. Vorou RM: Crimean-Congo hemorrhagic fever in southeastern in Kosovo during epidemic in 2013 (in Albanian language). National Europe.  Int J Infec Dis, 13, 659-662, 2009. DOI: 10.1016/j.ijid.2009.03.028 Conference of CCHF in Kosovo. Malisheve, April, 2015. Kafkas Univ Vet Fak Derg KafKas Universitesi veteriner faKUltesi Dergisi 22 (2): 305-308, 2016 JoUrnal Home-Page: http://vetdergi.kafkas.edu.tr Case Report DOI: 10.9775/kvfd.2015.14298 online sUbmission: http://vetdergikafkas.org Treatment of Complete Urethral Obstruction by using Pneumatic Lithotripsy in a Dog: A Preliminary Report [1,2] Mehmet MADEN 1 Merve İDER 1 Kurtuluş PARLAK 2 Ahmet ÖZTÜRK 3 [1] Presented at 11th Veterinary Internal Medicine Congress (Samsun, Turkey, 21-24 May 2015) as an oral presentation [2] Presented at 32nd World Veterinary Congress (Istanbul on September 13-17, 2015) as an poster presentation 1 Selcuk University, Faculty of Veterinary Medicine, Department of Internal Medicine, TR-42079 Konya - TURKEY 2 Selcuk University, Faculty of Veterinary Medicine, Department of Surgery, TR-42079 Konya - TURKEY 3 Necmettin Erbakan University, Faculty of Medicine, Department of Urology, TR-42080 Konya - TURKEY Article Code: KVFD-2015-14298 Received: 26.08.2015 Accepted: 29.09.2015 Published Online: 29.09.2015 Abstract In this preliminary case presentation, use of the minimally invasive cystoscopic pneumatic lithotripsy technique in the treatment of complete urethral obstruction in a dog has been described. The animal of the case comprised a 5-year old Chihuahua presenting with difficulty during urination and inability to urinate for the previous 2 days. Post-renal azotemia and hematuria was determined. Urethral stones causing complete urethral obstruction were visualized via cystoscopy, fragmented with a pneumatic lithotripter and the stone fragments were removed using the voiding urohydropulsion method. In conclusion, the pneumatic lithotripsy method was successfully used in the treatment of complete urethral obstruction. Keywords: Pneumatic lithotripsy, Urethroscopy, Urethral stone, Obstruction, Dog Bir Köpekte Tam Üretral Obstrüksiyonun Pnömatik Litotripsi İle Tedavisi: İlk Rapor Özet Bu olgu sunumunda bir köpekte tam üretral obstrüksiyonun tedavisinde minimal invaziv sistoskopik pnömatik litotripsi tekniğinin kullanımı anlatıldı. Olgunun hayvan materyalini idrar yaparken zorlanma ve son iki gündür idrar yapamama şikâyetleri ile getirilen, postrenal azotemia ve hematuria tespit edilen Chihuahua ırkı, 5 yaşlı bir köpek oluşturdu. Tam üretral obstrüksiyona neden olan üretral taşlar sistoskopi ile görüntülendi, pnömatik litotriptör kullanılarak parçalandı ve taş fragmanları voiding urohydropulsiyon yöntemiyle dışarıya alındı. Sonuç olarak, pnömatik litotripsi yöntemi tam üretral obstrüksiyonun tedavisinde başarılı bir şekilde kullanıldı. Anahtar sözcükler: Pnömatik litotripsi, Üretroskopi, Üretral taş, Obstrüksiyon, Köpek INTRODUCTION electrohydrolic, ultrasonic, pneumatic and Holmium-YAG laser lithotripsy techniques are widely used in this field [1]. Lithotripsy derives from the Greek words “lith” stone and “tripsis” to break and is a procedure literally meaning Pneumatic lithotripsy (PL) was developed in the “breaking stones”. It was first used to fragment kidney 1990s. The method utilizes a rigid energy probe placed stones in humans at Munich University on 7th February directly onto the stone and the stone is then broken into 1980. This technique was named “Extracorporeal Shock fragments by a drill-like effect due to the energy of the Wave Lithotrpisy” (ESWL). ESWL was followed by the compressed air. The PL method provides a practical and development of intracorporeal techniques administered low cost treatment approach in urethral stones due to its directly onto the stone using endoscopic methods. reusable probe [2]. Pneumatic lithotripsy is used extensively Fragmenting of bladder stones became easier with in human medicine [3-5]. In veterinary medicine, it was first the development of lithotripters applied directly onto demonstrated in fragmenting stones placed in the ureters the surface of the stone guided by a cystoscope. The of dogs and pigs in an experimental study [6].  İletişim (Correspondence)  +90 332 2233596  mmaden@selcuk.edu.tr 306 Treatment of Complete ... In this case report, the use of a pneumatic lithotripter lithotripter (Fig. 1) and the urethra was unblocked. The under the guidance of a rigid cystoscope in the treatment bladder was then entered and stones in the bladder were of total urethral obstruction in a 5-year old Chihuahua dog fragmented. The stone fragments were removed via urination has been described. using the voiding urohydropulsion method (Fig. 3) [7-9]. The voiding urohydropulsion method was repeated 3 times. CASE HISTORY DISCUSSION The case was a 5-year old Chihuahua, brought to the Small Animal Hospital of Veterinary Faculty, Selçuk In this preliminary case report, use of minimally invasive University. The case presented difficulty in urination cystoscopic pneumatic lithotripsy method in the treatment (dysuria, stranguria), inappetence, lethargy and inability to urinate for the previous 2 days. Physical examination of the dog revealed normal body temperature, heart rate and respiratory rate. Distension and pain in the caudal abdomen along with a full urinary bladder were determined upon abdominal palpation. The dog frequently exhibited urination position but was unable to urinate. A full bladder was observed on direct radiographs with no other abnormalities detected. On ultrasound examination, structures presenting acoustic shadows were identified in the bladder and proximally to the os penis. The urethral catheterization attempt after decompressive cystocentesis was unsuccessful. Therefore, it was decided to perform cystoscopy in the dog. The patient’s haematological, venous blood gases, serum biochemistry and urine analysis data are shown in Table 1. Haematology and venous blood gas data was within the normal range, however, post- renal azotaemia and haematuria was determined. Prior to cystoscopy, the patient was anaesthetized with xylazine (Rompun® Bayer, 2 mg/kg, IM) and ketamine (Ketasol® Interhas, 10 mg/kg, IM). On rigid cystoscopic examination, 2 yellow and rough-surfaced stones proximal to the os penis were seen to have completely obstructed the urethra Fig 1. Pneumatic lithotripter and rigid endoscope (A), lithotripter unit (B) (Fig. 2). The stones were fragmented using a pneumatic Şekil 1. Pnömatik litotriptör ve rigid endoskop (A), litotriptör ünitesi (B) Table 1. Laboratory results Tablo 1. Laboratuar sonuçlar Haematology Blood Gases (Venous) Serum Biochemistry Urinalysis WBC (m/mm3) 12.67 pH 7.34 BUN (mg/dl) 57 Colour Yellow Lymphocyte (%) 52.5 pCO2 (mmHg) 37 Creatinine (mg/dl) 2.3 Appearence Transparancy Monocyte (%) 21.9 pO2 (mmHg) 37 GGT (IU/L) 11.0 SpG 1.020 Granulocyte (%) 25.6 Na+ (mmol/L) 152 ALT (IU/L) 70 pH 6.0 Lymphocyte (m/mm3) 6.65 K+ (mmol/L) 3.3 ALP (IU/L) 18 Protein +1 Monocyte (m/mm3) 2.77 Ca++ (mmol/L) 0.61 Calcium (mg/dl) 8.8 Glucose - Granulocyte (m/mm3) 3.25 Glucose (mg/dl) 122 Phosphorus (mg/dl) 6.8 Keton - RBC (M/mm3) 8.99 Lactate (mmol/L) 3.3 Cholesterol (mg/dl) 237 Bilirubin - MCV (fl) 46.7 HCO -3 (mmol/L) 20.0 Triglyceride (mg/dl) 127 Blood -/+ intact PCV (%) 41.9 TCO2 (mmol/L) 21.1 Total Protein (g/dl) 6.1 Nitrite - MCH pg 17.2 BEecf (mmol/L) - 5.8 Albumin (g/dl) 4.0 RBC/HPF ++ moderate MCHC (g/dl) 36.9 BE(B) (mmol/L) - 5.2 Glucose (mg/dl) 215 WBC/HPF - RDW 12.1 SO2c (mmol/L) 66 T. Bilirubin (mg/dl) 1.8 Casts/HPF - Haemoglobin (g/dl) 15.5 THbc (g/dl) 14.6 Bacteria - Trombocyte (m/mm3) 159 Crystal - 307 MADEN, İDER PARLAK, ÖZTÜRK Fig 2. Endoscopic appearance of urethral stones Şekil 2. Üretral taşların endoskopik görünümü of complete urethral obstruction caused by stones was described in a dog. The obstruction was successfully resolved and no complications were encountered. The movement of stones from bladder into urethra is among the most frequent causes of urinary obstruction in dogs. Small breeds are more affected [10]. The urethral obstruction is most commonly reported in the proximal part of os penis, where the urethral diameter is relatively narrow. Urethral stones can be removed using hydro- pulsion, lithotripsy and basket retrieval methods [9], as well as the surgical options of cystotomy and cysto- lithotomy [11-14]. In this case report, no stones could be visualized on radiographic examination but ultra- sonographic examination revealed presence of stones in the bladder and acoustic shadows. In the light of the radioluscent stones present in the bladder and urethra, as well as the acidic nature of the urine pH, it was estimated that this could be either cysteine or urate [15]. Stone analysis could not be performed. The urethral obstruction determined to be located proximally to os penis was cleared using cystoscope-guided pneumatic lithotripsy [3-5] and voiding urohydropulsion [7-9]. Fig 3. The application of voiding urohydropulsion Şekil 3. Voiding urohydropulsion uygulaması Electrohydrolic (ELH) and Ho : YAG (holmium : yttrium, aluminium, garnett) laser lithotripsy methods are used Major perioperative complications in the laser litho- to fragment stones in the urinary system [10,16-20]. ELH tripsy are death, urethra or bladder perforation and urethral is recommended as a minimally invasive method in obstruction; while minor perioperative complications fragmenting urethral stones in males and bladder stones are haematuria, leukocyturia and infection of the urinary in females [18]. Endoscopic laser techniques remain limited system [20]. In studies where Ho : YAG laser lithotripsy was in dogs weighing less than 6-8 kg and, in particular, due used, haematuria was seen in 18 of 25 dogs during the to the restriction of distensibility in the ventral groove procedure and in 9 dogs after the procedure [19]. In another of os penis [10,19]. This method has been reported to have study, immediately after lithotripsy, focal lesions, erosions, advantageous in avoiding urethral mucosa damage [21], hemorrhage and ulceration were seen in 4 of 19 dogs. however, studies have also reported complications such These lesions were formed mostly due to the effect of as haematuria [19,20], superficial mucosal damage [21,22] and the stone and tissue damage originating from laser had secondary stenosis resulting from thermal damage [6] only developed in 1 case [21]. In another laser lithotripsy caused by electrohydrolic/ultrasonic probes. High cost of procedure performed under the guidance of a cystoscope, the equipment and the need for technical experience is complication rates were found to be 17.9% and 13.3% in also among limiting factors [12]. females and males, respectively [10]. 308 Treatment of Complete ... Pneumatic lithotripsy is recommended as a useful, impactor. Urology, 44, 937-941, 1994. DOI: 10.1016/S0090-4295(94)80190-8 effective and low cost method in the removal of ureter 7. Lulich JP, Osborne CA: Management of urocystoliths by voiding stones in human medicine [3-5,23]. In this case report, urethral urohydropropulsion. Vet Clin North Am: Small Anim Pract, 26, 629-637, stones causing complete urethral obstruction and stones 1996. DOI: 10.1016/S0195-5616(96)50088-4 in the bladder were visualized via cystoscopy, fragmented 8. Lulich JP, Osborne CA, Sanderson SL, Ulrich LK, Koehler LA, Bird KA, Swanson LL: Voiding urohydropropulsion lessons from 5 years of with a pneumatic lithotripter and stone fragment were experience. Vet Clin North Am: Small Anim Pract, 29, 283-291, 1999. DOI: removed using the voiding urohydropulsion method (Fig. 10.1016/S0195-5616(99)50016-8 3). The pneumatic lithotripsy technique was successfully 9. Osborne CA, Lulich JP, Polzin DJ: Canine retrograde urohydroplusion. performed under the guidance of a 3-mm rigid endoscope Lessons from 25 years of experience. Vet Clin North Am: Small Anim Pract, in a relatively small dog of 3.4 kg/BW and this technique 29, 267-281, 1999. DOI: 10.1016/S0195-5616(99)50015-6 was tolerated well by the dog. Compared to other litho- 10. Adams LG, Berent AC, Moore GE, Bagley DH: Use of laser lithotripsy [10,17-19] for fragmentation of uroliths in dogs: 73 cases (2005-2006). J Am Vet Med tripsy methods , no complication other than minimal Assoc, 232, 1680-1687, 2008. DOI: 10.2460/javma.232.11.1680 mucosal bleeding observed during fragmenting the 11. Grant DC, Harper TAM, Were SR: Frequency of incomplete urolith urethral stone was seen after the procedure. Protective removal, complications, and diagnostic imaging following cystotomy antibiotics (Baytril® Bayer, 5 mg/kg/daily, PO) were for removal of uroliths from the lower urinary tract in dogs: 128 cases prescribed following the procedure. (1994-2006). J Am Vet Med Assoc, 236, 763-766, 2010. DOI: 10.2460/ javma.236.7.763 In conclusion, the pneumatic lithotripsy method was 12. Libermann SV, Doran IC, Bille CR, Bomassi EG, Rattez EP: Extraction successfully used in the treatment of complete urethral of urethral calculi by transabdominal cystoscopy and urethroscopy in obstruction. As the pneumatic lithotripsy method was nine dogs. J Small Anim Pract, 52, 190-194, 2011. DOI: 10.1111/j.1748-5827.2011.01045.x a useful, low-cost, practical and minimally invasive 13. Runge JJ, Berent AC, Mayhew PD, Weisse C: Transvesicular technique in the fragmenting of urethral and bladder percutaneous cystolithotomy for the retrieval of cystic and urethral stones, authors suggest that based on its use in human calculi in dogs and cats: 27 cases (2006-2008). J Am Vet Med Assoc, 239, medicine, the pneumatic lithotripsy method coupled with 344-349, 2011. DOI: 10.2460/javma.239.3.344 a flexible cystoscope may be of help in treating ureter and 14. Jattennavar PS, Kalmath GP: Urethral obstruction by urinary calculi bladder stone. However further clinical studies are needed in a pomeranian dog. Indian J Anim Res, 46(1), 100-102, 2012. for this purpose. 15. Lulich JP: Accurate and efficient management of canine urolithiasis: Diagnosis to prevention. 1st Seminar of Veterinary Urology, 18-19 December, Ankara, 2014. ConfliCt of interest 16. Fried NM: New technologies in endourology potential applications Authors disclose no conflict of interest. of the Erbium:YAG laser in endourology. J Endourol, 15 (9): 889-894, 2001. 17. Adams LG, Williams Jr JC, McAteer JA, Hatt EK, Lingeman JE, REFERENCES Osborne CA: In vitro evaluation of canine and feline calcium oxalate urolith fragility via shock wave lithotripsy. Am J Vet Res, 66, 1651-1654, 1. Lulich JP, Adams LG, Osborne CA: Lithotripsy. In, Elliott J, Gregory 2005. DOI: 10.2460/ajvr.2005.66.1651 F. Grauer GF (Eds): BSAVA Manual of Canine and Feline Nephrology and 18. Defarges A, Dunn M: Use of electrohydraulic lithotripsy in 28 dogs Urology. 2nd ed., 198-203, BSAVA, 2007. with bladder and urethral calculi. J Vet Intern Med, 22, 1267-1273, 2008. 2. Miller J, Stoller ML: Intracorporeal lithotripsy: Electrohydraulic, DOI: 10.1111/j.1939-1676.2008.0193.x pneumatic, and ultrasonic. In, Manoj Monga M (Ed): Ureteroscopy - 19. Grant DC, Were SR, Gevedon ML: Holmium:YAG laser lithotripsy Indications, Instrumentation & Technique. 149-160, Springer Science for urolithiasis in dogs. J Vet Intern Med, 22, 534-539, 2008. DOI: Business Media, New York, 2013. 10.1111/j.1939-1676.2008.0083.x 3. Hofbauer J, Hobarth K, Marberger M: Electrohydraulic versus 20. Lulich JP, Osborne CA, Albasan H, Monga M, Bevan M: Efficacy pneumatic disintegration in the treatment of ureteral stones: A and safety of laser lithotripsy in fragmentation of urocystoliths and randomized, prospective trial. J Urol, 153, 623-625, 1995. DOI: 10.1016/ urethroliths for removal in dogs. J Am Vet Med Assoc, 234, 1279-1285, S0022-5347(01)67667-5 2009. DOI: 10.2460/javma.234.10.1279 4. Atar M, Bodakci MN, Sancaktutar AA, Penbegul N, Soylemez H, 21. Davidson EB, Ritchey JW, Higbee RD, Lucroy MD, Bartels KE: Laser Bozkurt Y, Hatipoglu NK, Cakmakci S: Comparison of pneumatic and lithotripsy for treatment of canine uroliths. Vet Surg, 33, 56-61, 2004. DOI: laser lithotripsy in the treatment of pediatric ureteral stones. J Pediatr 10.1111/j.1532-950x.2004.04002.x Urol, 9, 308-312, 2013. DOI: 10.1016/j.jpurol.2012.03.004 22. Mustafa M, Pancaroglu K: Urine cytology to evaluate urinary 5. Degirmenci T, Gunlusoy B, Kozacioglu Z, Arslan M, Koras O, Arslan urothelial damage of shock-wave lithotripsy. Urol Res, 39, 223-227, 2011. B, Minareci S: Comparison of Ho:YAG laser and pneumatic lithotripsy DOI: 10.1007/s00240-010-0339-5 in the treatment of impacted ureteral stones: An analysis of risk factors. 23. Farahat YA, Elbahnasy AEM, Elashry OM: A randomized prospective Kaohsiung J Med Sci, 30, 153-158, 2014. DOI: 10.1016/j.kjms.2013.08.007 controlled study for assessment of different ureteral occlusion devices in 6. Grasso M, Loisides P, Beaghler M, Bagley D: Treatment of urinary prevention of stone migration during pneumatic lithotripsy. Urology, 77, calculi in a porcine and canine model using the browne pneumatic 30-35, 2011. DOI: 10.1016/j.urology.2010.05.063 Kafkas Univ Vet Fak Derg KafKas Universitesi veteriner faKUltesi Dergisi 22 (2): 309-313, 2016 JoUrnal Home-Page: http://vetdergi.kafkas.edu.tr Case Report DOI: 10.9775/kvfd.2015.14365 online sUbmission: http://vetdergikafkas.org Morphological and Etiological Investigations in A Rotaviral Enteritis Outbreak in Calves Ismet KALKANOV 1 Ivan DINEV 1 Marin ALEKSANDROV 2 Kiril DIMITROV 1 Ivan ZARKOV 3 1 Department of General and Clinical Pathology, Faculty of Veterinary Мedicine, Trakia University, Stara Zagora, BULGARIA 2 Institute of Experimental Pathology and Parasitology, Bulgarian Academy of Sciences, Sofia, BULGARIA 3 Department of Veterinary Microbiology, Infectious and Parasitic Diseases, Faculty of Veterinary Мedicine, Trakia University, Stara Zagora, BULGARIA KVFD-2015-14365 Received: 11.09.2015 Accepted: 18.12.2015 Published Online: 07.01.2016 Abstract The aim of the present report was to describe the gross pathology and histopathologic findings and etiological investigations in a diarrhoeic syndrome outbreak in calves from the 24th h to 20th day of life. Clinically, affected animals exhibited profuse diarrhoea with yellow-greenish faeces mixed with mucus and blood. Rapid field tests Rainbow calf scour 5 BIO K 306 Detection of Rotavirus, Coronavirus, E. coli F5, Cryptosporidium parvum and Clostridium perfringens in bovine stool and ELISA was used for detection of Rotavirus, Coronavirus, E. coli F5, Cryptosporidium parvum antigens. The results of tests were positive for Group A bovine rotavirus, and negative for all other tested etiological agents. The gastrointestinal tract macroscopic lesions observed during the gross pathological examination were of inflammatory nature. Microscopic lesions confirmed the catarrhal desquamative enterocolitis through marked lymphocytic infiltration and oedema of intersitial tissues and submucosa. Non-complicated rotaviral enteritis was capable of inducing pathological alterations of the gastrointestinal tract in neonatal calves with high mortality rates. Keywords: Rotavirus enteritis, Diarrhoea, Group A bovine rotavirus, Calves Buzağılarda Gözlenen Bir Rotavirus Enteritis Salgınında Morfolojik ve Etiyolojik Araştırmalar Özet Bu çalışmanın amacı buzağılarda 24. saat ile 20. gün arasında şekillenen diare sendromu salgınında makroskobik ve histopatolojik bulguların tanımlanarak etiyolojinin araştırılmasıdır. Klinik olarak hasta hayvanlarda mukus ve kan ile karışık sarı yeşilimtırak renkli dışkı ile karakterize şiddetli ishal gözlemlendi. Hızlı saha testi, Rainbow calf scour 5 BIO K 306, dışkıda Rotavirus, Coronavirus, E. coli F5, Cryptosporidium parvum ve Clostridium perfringens antijenlerini belirlemek amacıyla kullanıldı. Testin sonuçları Grup A bovine rotavirus için pozitif ve diğer tüm etkenler için negatif olarak belirlendi. Gastrointestinal system organlarda gözlemlenen patolojik değişiklikler yangısal karakterdeydi. Mikroskobik bakıda intersitisyel dokuda ve submukozada şiddetli lenfositik infiltrasyon ve ödem ile karakterize kataral deskuamatöz enterokolitis tespit edildi. Komplike olmayan rotavirus enteritis gastrointestinal sistemde patolojik değişiklikler yapabilme ve yüksek mortalite özelliklerine sahip olabilmektedir. Anahtar sözcükler: Rotavirus enteritisi, Diare, Grup A bovine rotavirus, Buzağı INTRODUCTION induce disease in men and ruminants. Group B affects calves, lambs and men. Group C affects mainly pigs and in Rotaviruses provoke a number of gastrointestinal some instances, men. Groups D, F and G provoke disease in illnesses in infants, calves, pigs, foals, lamb, rabbits, domestic fowl [3,5]. Nevertheless, Group A rotaviruses are antelopes, mice and exotic species (grizzly bears, red the main causative agents of infection in livestock [4,6,7]. kangaroos etc.) [1,2]. Group А (gpA) bovine rotaviruses (GPA Group А bovine rotaviruses are enteropathogenic and are BRV) are a genus within the family of Reoviridae. On the most commonly associated with the etiology of neonatal basis of antigen specificity rotaviruses are classified into calf diarrhoea from the birth to the 30th day of the age [8-10]. groups, subgroups and serotypes [3,4]. Group А viruses Usually, the virus affects calves around the 3rd week of age,  İletişim (Correspondence)  +359 888 452098  ismet_88@abv.bg 310 Morphological and Etiological ... with highest frequency until 6 days of age. After entering rinse on drops of phosphate buffer, the SpA-convalescent the host, the incubation period of the virus is relatively short sera-antibody-coated grids were left overnight on drops of (about 24 h) and the duration of diarrhoea - 2-5 days [5,11]. supernatant of faecal probes diluted with an equal volume In neonatal calves, the infection is characterized with of 0.2 M phosphate buffer and centrifuged at 5.000× g for the lack of viraemic stage, short incubation period, and 30 min. Finally, the negative staining of all preparations profuse diarrhoea combined with severe dehydration. was carried out with a 2% sodium phosphotungstate, The simultaneous infection with secondary pathogens pH 6.8. The examinations were carried out on an electron complicates the course of the disease [12,13]. The onset of microscope JEOL 1200 EX at an accelerating voltage of 80 diarrhoea is due to the replication of the virus within the kV and an instrumental magnification of 6.000-70.000X. enterocytes and perished absorbing enterocytes with activation of enteric nervous system by the rotavirus Necropsy of 6 dead calves was done following the enterotoxin [14]. standard protocol. Specimens from affected gastro- intestinal compartments were collected for histopathological The purpose of the present report was to describe the examination. Materials were fixed in 10% neutral buffered results from gross pathology and etiological investigations formalin and embedded in paraffin. The cross sections in a diarrhoeic syndrome outbreak in calves from the 24th were stained with haematoxylin-eosin. From the same h to 20th day of life. carcasses, samples from viscera (liver, heart, spleen, mesenteric lymph nodes) were obtained for conventional CASE HISTORY bacteriology. The results from rapid antigenic tests proved the In the cattle farm, 13 of 40 diseased calves, 5 to 20 presence of coproantigens against Group A bovine rotavirus days of age, have died during 3-week period. The disease in all 10 calves. These results were also confirmed with occurred spontaneously, and the most prominent clinical ELISA test (Fig. 1) with positive results in 12 samples out sign of disease was the diarrhoeic syndrome. Profuse of 22 examined faecal samples. The antigen tests showed diarrhoea with yellow-greenish faeces, mixed with mucus that all studied 22 faecal samples were positive for Group and blood in 4 of calves, was observed. The course of the A bovine rotavirus (Table 1). There were no antigens of the disease developed within 24 to 96 h, with dehydration other etiological agents of neonatal calf diarrhoea. The and fatal outcome. immunoelectron microscopy exhibited accumulation of A total of 32 animals were included in the study. Rectal rotaviral particles, distributed evenly along the grid under faecal content samples were collected from 10 calves the form of various number of virion aggregates (Fig. 2). with clinical signs from 7 to 20 days of age which were Gross pathology findings were similar in all necropsied analysed with rapid field test Rainbow calf scour 5 BIO animals. The external appearance of the carcass showed K 306 Detection of Rota, Corona, E. coli F5, Crypto and signs of severe dehydration and enophtalmos without Clostridium perfringens (BIOX Diagnostics, Belgium). The other obvious changes. The perianal region was stained tests detect 5 of causative agents of neonatal calf diarrhoea with yellow-greenish faeces. After dissection of the Rotavirus, Coronavirus, E. coli-F5, Cryptosporidium parvum and Clostridium perfringens type А. Also, 2 g faecal samples were obtained from the rectums of 22 calves from 5 to 20 days of age for detection of antigens of Rota, Corona, E. coli F5, Crypto with ELISA (BIOX Diagnostics, Belgium) sandwich test for faeces. The serological trapping on antibody-coated electron microscope grids approach of Nicolaieff et al.[15] was used for immunoelectron microscopic detection of viruses in faeces from diarrhoeic calves. Briefly, 20-40 days after the appearance of clinical signs convalescent sera were taken from 5 calves recovered from diarrhoeic syndrome. The faecal test materials for electron microscopic analyses were obtained from 5 acutely diarrhoeic calves from 6 to 12 days of age. Butvar and carbon coated 400 mesh copper grids were floated over drops of protein A solution (usually 26 Fig 1. Positive results of sandwich ELISA test for faeces. Blue-coloured wells demonstrate the presence of antigens against rotavirus in calf µg/ml) for 20 min. Then they were washed 4 times on drops faecal samples of 0.1 M sodium phosphate buffer (pH 7.0). Thereafter, the Şekil 1. Dışkı örneklerinde sandviç ELISA pozitif sonuçları. Mavi renkli grids were floated on drops of diluted convalescent sera hücreler buzağı dışkı örneklerinde rotavirusa karşı antijenlerin varlığını 1:40 in phosphate buffer for 2 h. After an intermediate göstermektedir 311 KALKANOV, DINEV, ALEKSANDROV DIMITROV, ZARKOV Table 1. Summary of data from etiological antigenic tests Tablo 1. Etiyolojik antijenik test sonuçları Total Number of Number of Number of Number of Number of Samples Test Faecal Samples from Samples Positive Samples Positive Samples Positive Positive for а Calves n=32 for BRV for BCoV for E. coli F5 C. parvum Rainbow calf scour 5 BIO K 306 10 10 0 0 0 ELISA sandwich test 22 12 0 0 0 Total number of positive samples 22 0 0 0 abdomen, the abdominal cavity contained excessive amount of opaque fluid. Multiple haemorrhages on the mucosa of fore stomachs were detected. The most severe changes were observed in the small intestine, corresponding to acute catarrhal haemorrhagic enteritis. The affected compartments were dilated, with moist intestinal content and meteorism. The colour of intestinal content was yellow-greenish, mixed with numerous gas bubbles. Mesenteric lymph nodes were markedly enlarged and swollen. The abomasum was filled with milk coagula, and its mucosa - hyperaemic and spattered with multiple erosions and few ulcerations. The liver had an enlarged gallbladder and a frail consistency. In the medullary region of both kidneys, a strong hyperaemia was seen. Petechial and ecchymotic haemorrhages of the epicardium were present. There were no relevant pathoanatomical changes on the other visceral organs. The histological study of small and large intestine revealed strong dystrophic and necrobiotic changes in enterocytes. A large amount of desquamated cells have shed into the lumen. Some of intestinal villi were strongly Fig 2. Immunoelectron microscopy of a faecal sample from diarrhoeic calf as per Nikolaieff et al.[15]. Rotavirus particles aggregate. Negative atrophied, and crypts – severely dilated in some areas (Fig. contrasting with 2% sodium phosphotungstate рН 6.8 3). The propria was infiltrated with numerous lymphocytes, Şekil 2. Nikolaieff et al.[15] tarafından tanımlanan bir ishalli buzağı dışkı and submucosa had a marked oedema and hyperaemia örneğininde rotavirus partikülleri. 2% sodium phosphotungstate рН (Fig. 4). The studied bacteriological samples were negativе 6.8 ile negatif kontrast for bacterial agents. Fig 3. Transverse cross section of the jejunum. Presence of specific pseudocystic formations within the mucosa, including inflammatory cell exudate (C), H/Е. Bar=50 µm Şekil 3. Jejenumun transversal kesiti. Mukozada spesifik psödokistik oluşumlar (C) ve yangısal hücre infiltrasyonu, H/Е. Bar=50 µm 312 Morphological and Etiological ... Fig 4. Transverse cross section of the ileum. Intense serous haemorrhagic and desquamative catarrh within the mucosa (M) and a diffuse inflammatory cell infiltration of the submucosa (SM), (Black arrows), H/Е. Bar=100 µm Şekil 4. İleumun transversal kesiti. Mukozada şiddetli seröz, hemorajik ve deskuamatöz kataral yangı ve submukozada diffuz yangısal hücre infiltrasyonu (SM), (siyah oklar), H/Е. Bar=100 µm DISCUSSION and fusion of individual villi, with involvement of the crypts epithelium [18]. In the distal section of the small The results from the present etiological studies proved intestine (ileum) were focused histological changes in the presence of a rotaviral monoinfection with high E. coli infection. In addition to atrophy and collection of morbidity and mortality rate during the first 20 days of individual villi were observed and also a large number of [19] calves’ life. Our results are comparable to other reports [13]. bacteria on their surface . Even as a non-complicated infection, rotaviral enterites Compared to microscopic lesions (epithelial cell could entail high morbidity and mortality among neo- desquamation in distal small intestine and proximal colon) natal calves. observed by us in an Cryptosporidium parvum outbreak [14], The method of immune electron microscopy the present report from the confirmed rotaviral infection demonstrated the presence of rotavirus particles in faecal provided also evidence for damage of crypts in the distal samples from calves with diarrhoea, which confirms the ileum. results of our previous studies. In 1969, the method was The performed examinations allowed concluding that used to detect the viruses causing diarrhoea in calves, the antigen diagnostic tests as Rainbow calf scour 5 BIO and named “the gold standard” in the diagnosis of viral K 306 and ELISA (BIOX Diagnostics, Belgium) combined enteritis in calves [16]. with gross anatomy and histopathological findings are appropriate for diagnostics and differential diagnostics of In contrast of the direct immune electron microscopy, gastrointestinal diseases in neonatal and juvenile calves. electron microscopy has greater sensitivity, consisting in using a specific antibody for searching virus. Both REFERENCES methods, ELISA and immune electron microscopy have a high sensitivity ranging from 87% to 100% of the different 1. McGuire SJ, Castro AE: Evaluation of a commercial immunoassay for viral agents, which gives them good diagnostic value [17]. rapid diagnosis of rotavirus in fecal specimens from domestic species. Proc Annu Meet Am Assoc Vet Lab Diagn, 25, 375-388, 1982. The observed microscopic lesions in the distal 2. Woode GN, Bridger JC, Jones JM: Morphological and antigenic compartment of small intestines characteristic for severe relationships between viruses (rotaviruses) from acute gastroenteritis of surface desquamation of epithelial cells and atrophy of children, calves, piglets, mice, and foals. Infect Immun, 14, 804-810, 1976. some villi, as well as the proliferation of the propria with 3. Desselberger U, Gray J, Estes M: Rotaviruses. In, Mahy BWJ, Meulen VT (Eds): Topley and Wilson’s Microbiology and Microbial Infections. 946- lymphocytes, are at the background of the pathogenesis 958, ASM Press, USA, 2005. of rotaviral enterites in calves, as also stated by other 4. Villarreal LY, Uliana G, Valenzuela C, Chacon J, Saidenberg A, researchers [12]. Sanches A, Brandao P, Jerez J, Ferreira A: Rotavirus detection and isolation from chickens with or without symptoms. Revue Brasilia Ciencia Pathomorphological changes in the intestine and Avicola, 8, 187-191, 2006. DOI: 10.1590/S1516-635X2006000300009 colon in coronavirus infection were expressed in atrophy 5. Steele AD, Geyer A, Gerdes G: Rotavirus infections. In, Coetzer JAW, 313 KALKANOV, DINEV, ALEKSANDROV DIMITROV, ZARKOV Tustin RC (Eds): Infectious Diseases of Livestock. 1256-1264, Oxford 12. Torres-Medina A, Schlafer D, Mebus C: Rotaviral and coronaviral University Press, Southern Africa, 2004. diarrhea. Vet Clin North Am: Food Anim Pract, 1 (3): 471-493, 1985. 6. Snodgrass DR, Herring J, Campbell I, Inglis M, Hargreaves F: 13. Mebus CA, Staire L, Underdanhl R, Twienaums J: Pathology of Comparison of atypical rotavirus from calves, piglets, lambs and man. J neonatal calf diarrhoea induced by a reo-like virus. Vet Pathol, 8, 490-505, General Virology, 65, 909-914, 1984. DOI: 10.1099/0022-1317-65-5-909 1971. DOI: 10.1177/0300985871008005-00612 7. Ghosh S, Varghese V, Sinha M, Kobayashi N, Naik T: Evidence for 14. Kalkanov I, Dinev I, Dimitrov K, Iliev P: Clinical and morphological interstate transmission and increase in prevalence of bovine group B investigations in a spontaneous cryptosporidium enteritis outbreak in rotavirus strains with a novel VP7 genotype among diarrhoeic calves in calves. Bulgarian J Vet Med, 2015. DOI: 10.15547/bjvm.924 Eastern and Northern states of India. Epidemiol Infect, 135, 1324-1330, 2007. 15. Nikolaieff A, Obert G, Regenmorter M: Detection of rotavirus by DOI: 10.1017/S0950268806007813 serological trapping on antibody-coated electron microscope grids. J 8. Lucchelli A, Lance S, Bartlett P, Miller G, Saif L: Prevalence of bovine Clin Microbiol, 12 (1): 101-104, 1980. group A rotavirus shedding among dairy calves in Ohio. Am J Vet Res, 53, 16. Brugere-Picoux J, Tessier P: Viral gastroenteritis in domestic animals 169-174, 1992. and zoonoses. Bull Acad Natl Med, 194, 1439-1449, 2010. 9. Ishizaki H, Ohta C, Shirahata T, Goto H, Taniguchi K, Urasawa T, 17. Schroeder ME, Bounpheng MA, Rodgers S, Baker RJ, Black W, Urasawa S: Persistence of a single electropherotype and serotype (G6P5) Naikare H, Velayudhan B, Sneed L, Szonyi B, Clavijo A: Developmen of bovine rotavirus in calves on a closed dairy farm from 1990 to 1993. and performance evaluation of calf diarrhea pathogen nucleic acid Am J Vet Res, 56, 1019-1024, 1995. purification and detection workflow. J Vet Diagn Invest, 24, 945-953, 2012. 10. Vende P, Karoum R, Manet G, Rizet C, Schelcher F, Cohen DOI: 10.1177/1040638712456976 J, Navet H: Molecular epidemiology of bovine rotaviruses from the 18. Kapil S, Pomeroy KA: Experimental infection with a virulent Charolais area. Vet Res, 30, 451-456, 1999. pneumo-enteric isolate of bovine corona virus. J Vet Diagn Invest, 3, 88- 11. Hall GA, Bridger J, Parson K, Cook R: Variation in rotavirus 89, 1991. virulence: A comparison of pathogenesis in calves between two rotavirus 19. Francis DH, Allen SD, White RD: Influence of bovine intestinal fluid of different virulence. Vet Pathol, 30, 223-233, 1993. DOI: 10.1177/ on the expression of K99 pili by Escherichia coli. Am J Vet Res, 50, 822- 030098589303000302 826, 1989. Kafkas Univ Vet Fak Derg KafKas Universitesi veteriner faKUltesi Dergisi 22 (2): 315-318, 2016 JoUrnal Home-Page: http://vetdergi.kafkas.edu.tr Case Report DOI: 10.9775/kvfd.2015.14373 online sUbmission: http://vetdergikafkas.org A Rare Complication of the Postpartum Period in a Dog: Vaginal Evisceration Güneş ERDOĞAN 1 Eyyüp Hakan UÇAR 1 Büşra KİBAR 2 Cevdet PEKER 1 Tuğra AKKUŞ 1 1 Department of Obstetrics and Gynecology, Faculty of Veterinary Medicine, Adnan Menderes University, TR-09100 Aydin - TURKEY 2 Department of Surgery, Faculty of Veterinary Medicine, Adnan Menderes University, TR-09100 Aydin - TURKEY Article Code: KVFD-2015-14373 Received: 11.09.2015 Accepted: 13.11.2015 Published Online: 13.11.2015 Abstract Transvaginal intestinal evisceration was observed in a 4-year-old bitch had given birth to four puppies ten days ago, normally. For treatment, median laparotomy was performed and intestinal loops were reduced via intra-abdominal traction. Intestinal anastomosis was performed on the necrotic part of bowel and the vaginal tear was sutured. According to owner’s request, the bitch underwent ovariohysterectomy. The dog was recovered without any complications. The absence of the main etiological factors in this case, suggests the presence of different factors that need to be investigated in the aetiology of the disease. To our knowledge, this case represents the first report of the successful management of transvaginal evisceration in pet practice. Keywords: Vaginal tear, Evisceration, Dog Köpekte Nadir Görülen Bir Postpartum Dönem Komplikasyonu: Vaginal Eviserasyon Özet On gün önce normal yolla 4 yavru doğurmuş olan 4 yaşlı bir köpekte transvaginal barsak eviserasyonu görüldü. Tedavi amacıyla median laparatomi uygulandı ve barsak segmenti abdomenden içeriye çekilerek red işlemi gerçekleştirildi. Dışarı çıkan barsak segmentinin nekrotik kısmında anostomoz uygulandı ve vaginal yırtık dikildi. Hasta sahibinin isteği üzerine ovariohisterektomi operasyonu ile hasta kısırlaştırıldı. Köpek herhangi bir komplikasyon oluşmadan iyileşti. Bu hastada vaginal rupturun bilinen nedenlerinin bulunmaması, hastalığın etiyolojisinde araştırılması gereken farklı etmenlerin varlığını düşündürmektedir. Bildiğimiz kadarıyla, bu olgu sunumu pet hekimliğinde başarıyla sağaltılmış ilk transvaginal eviserasyon raporudur. Anahtar sözcükler: Vaginal yırtık, Eviserasyon, Köpek INTRODUCTION cases, postoperative prognosis was reported as the poor, with high mortality. Therefore, it can be seen that the Obstetric injuries involving the rupture of the genital limited knowledge about the predisposing factors and tract in animals has been seen in periparturient stage, therapy of this rare emergency condition. usually during dystocia and also it need the acute surgery. Although the prevalence of obstetric injuries in dogs is In this case report, the clinical and operative findings not known exactly, the manual interventions [1], improper of the transvaginal small intestinal evisceration treated use of oxytocic drugs [2] and also oversized foetuses [3,4] successfully was presented in a dog, 10 days after normal are reported as high risk factors. According to previously parturition. articles, it is seen that a large portion of ruptures have been localized on the uterine wall. Meanwhile, limited reports CASE HISTORY about the complications of the vaginal tear following dystocia in dog [5-7] have been reported. Although the A 4-year-old female hound dog was referred to our surgical approaches were performed immediately in both clinic due to intestinal evisceration becoming in last hour.  İletişim (Correspondence)  +90 256 22470700/119, Fax: +90 256 22470720  gunesems@yahoo.com 316 A Rare Complication of the ... In patient history, it was recorded that the dog had immediately. While under general anaesthesia with 7 mg/ given birth to four healthy normal-sized puppies ten kg propofol (Propofol, Abbot®, Turkey) and 2% isoflurane days ago, normally. Parturition had taken place with- (Isoflurane®, Adeka, Turkey) the intestinal loops were reduced out any challenge and lasted about six hours. During via carefully intra-abdominal traction. The affected portion the subsequent ten days, no complication had been of the intestines was resected and a bowel anastomosis observed. was performed using 2-0 Polyglactin 910 (Vicryl®, Ethicon, UK) thread with Schimiden and Lembert sutures as On physical examination, the dog was recorded as shown Fig. 3. Moreover, the vaginal tear, the cause of severely underweight (15 kg), depressed with pain and this evisceration was detected on the left side of vagina dehydrated. It was clearly seen that the intestinal loops (9 centimetres from cervix) and it was repaired with 2-0 protruding from the rima vulva (Fig. 1). Moreover, a part Polyglactin 910 (Vicryl®, Ethicon, UK) thread with simple of small intestine turned to colour in dark purple and was continuous sutures (Fig. 4). The abdominal cavity was recorded in high risk of necrosis as shown Fig. 2. In vaginal flashed with warm 0.9% saline solution and intestines were digital examination, the localization of the vaginal tear repositioned in carefully. According to owner’s request, could not been detected. At first, the intestinal loops were the patient was spayed with ovariohysterectomy before washed with 0.9% saline solution and also a venous blood abdominal closure. Postoperatively, cephalosporin (Sefazol®, sample was taken for haematological analysis. Also, fluid Mustafa Nevzat, Turkey) was given for 7 days (30 mg/kg, therapy was initiated using lactated Ringers intravenously IM) every 12 h. Also, first four days was prescribed only fluid (iv). Test results were normally except the severe leuco- therapy by IV. Throughout four days was used every 12 h 50 cytosis (WBC=24.10x109/l, RBC=5.65x1012/l HGB=12.8 g/dl, ml of 5% dextrose, lactated Ringer 75 ml, 0.9% NaCl 250 ml, HCT=37.6%). Regarding to the intestinal rupture risk at the and Metronidazole (Flagyl®, Eczacıbaşı, Turkey) (25 mg/kg). manual reposition, median laparotomy was performed Next seven days was given water and diluted canine A/D Fig 1. Macroscopic appearance of transvaginal bowel evisceration Şekil 1. Transvaginal barsak eviserasyonunun makroskobik görünümü Fig 2. Necrotic part of intestines after washing the loops Şekil 2. Yıkama sonrası barsaktaki nekrotik kısım 317 ERDOĞAN, UÇAR, KİBAR PEKER, AKKUŞ Fig 3. Termino-terminal anastomosis procedure Şekil 3. Uçuca anostomoz uygulaması Fig 4. Suturing of vaginal tear (arrows), Cervix (C) Şekil 4. Vaginal yırtığın dikilmesi (oklar), Serviks (C) prescription diet. Next seven days was given macerated also traumatic coitus [11]. To date, more than 100 vaginal canine diet was started slowly a normal feeding. evisceration cases has been previously reported in literature [10], but only few reports in veterinary medicine. Neither general complications nor vaginal discharge Vaginal bowel evisceration cases have been recorded in occurred with surgery throughout the three days. The several farm animals [12-14] and dogs [5,15]. But to summarize results of the haematological analysis were recorded the predisposing factors is not possible due to low normally (WBC=13.30x109/l, RBC=5.3x1012/l, HGB=11.7 incidence. At breeding, the penetration of the penis to the g/dl, HCT=36.4%) at postoperatively 72 h. One week later, vaginal fornix can result to this condition in two mares [13]. the dog had recovered completely. At the examination And also, it was reported that the similar complication after six months postoperatively, dog was normal and in a dog following the forceful separation at mating [14]. had no complication originated from gastrointestinal and Meanwhile, another report is associated with pregnancy genital organs. The dog had got weight and was in good and parturition. Scott [13] warned that evisceration of general condition. intestines through a tear in the dorsal vaginal wall occurs spontaneously in heavily pregnant ewes during the last DISCUSSION month of gestation with the incidence between 2 and 5 per cent. Regarding to our presentation, two similar cases Vaginal evisceration characterized by internal organs have been reported in dogs with transvaginal evisceration prolapsing transvaginally is a rare emergency surgical after parturition [5,6]. In the first case, a perineal mass condition [8-10]. Depending on women’s sexual stage, this containing intestinal loops, bladder and uterine horns was condition is associated with pelvic prolapse, previous observed immediately after delivery of oversized foetuses pelvic surgery, especially vaginal hysterectomy, and resulted from tenesmus and/or due to oversized fetuses [5]. 318 A Rare Complication of the ... In the second case, it was observed that the vaginal to low temperature was observed after treatment. Also it rupture with bladder retroflexion and evisceration 45 days was not seen any complications throughout six months after delivery. However although the surgical treatment after operation. including ovariohysterectomy and partial vaginectomy was performed, both dogs were not survived. According In conclusion, it was presented that a case of transvaginal to author’s, deaths were attributed to the patient’s poor evisceration, which was seen on the postpartum tenth general condition and septic shock, respectively. day, and was successfully treated surgically without any complication. Given the preoperative and postoperative In the present case, the sizes of puppies were normal findings in this case, it should be considered that the and have no clinical signs related to foetal dystocia. After patient’s survival can be increased by proper surgical ten days parturition, all puppies were living without any treatment in this rare condition. health problem. However straining due to constipation is well-known as a risk factor for vaginal ruptures [10], there REFERENCES was no history about manual intervention in delivery, constipation, accidental trauma etc. according to owner’s 1. Humm KR, Adamantos SE, Benigni L, Armitage-Chan EA, Brockman report. Therefore, this condition suggests the presence DJ, Chan DL: Uterine rupture and septic peritonitis following dystocia and assisted delivery in a Great Dane bitch. J Am Anim Hosp Assoc, 46, of different factors that need to be investigated in the 353-357, 2010. DOI: 10.5326/0460353 aetiology of the disease. 2. Jackson PGG: Postparturient problems in dog and cat. In, Jackson PGG (Ed): Handbook of Veterinary Obstetrics. 2nd ed., 233-237, W.B. Saunders The suggested surgical option is a combined abdominal- Company, Philadelphia, 2004. vaginal approach especially in complicated cases [11]. In 3. Linde-Forsberg C and Eneroth A: Parturition. In, Simpson GM (Ed): this case presented, the similar surgical technique was Manual of Small Animal Reproduction and Neonatology. 127-142, British used successfully, combined with resection the necrotic Small Anim Vet Assoc, Gloucester, UK, 1998. part of intestine. Regarding to the poor reducibility and 4. Hajurka J, Macak V, Hura V, Statova L, Hajurka R: Spontaneous high rupture risk of damaged intestinal walls, only manual rupture of uterus in the bitch at parturition with evisceration of pupy intestine -A case report. Vet Med Czech, 50, 85-88, 2005. reduction of loops should not be performed. Following the 5. Prassinos NN, Adamama-Moraitou KK, Ververidis HN, Anagnostou resection of necrotic parts ex-situ, vaginal bowel traction TL, Kladakis SE: Vaginal rupture and evisceration in a dog. Acta Vet Hung, with abdominal laparotomy can be performed. 58, 309-315, 2010. DOI: 10.1556/AVet.58.2010.3.4 6. Coutinho BH, Labat E, Coutinho Junior AS, Curti MC, Pirolo J, de In human medicine, pelvic organ prolapses are Oliveira MLR, de Souza MSB: Retroflexion and evisceration of the described in detail under the heading “pelvic floor urinary bladder due to rupture of the genital organs in bitch. Ciencia disorders”. Normally, pelvic floor components surrounding Rural, 43, 318-321, 2013. DOI: 10.1590/S0103-84782013000200020 them keep the pelvic organs in place. In reconstructive 7. Mandell DC, Drobatz KI: Urinary bladder herniation through a vaginal pelvic surgery, numerous surgical methods with and tear in a Rottweiler with dystocia. J Vet Emerg Crit Care, 10, 173-175, 2000. DOI: 10.1111/j.1476-4431.2000.tb00008.x without graft materials have been used in pelvic support 8. Parra RS, Rocha JJR, Feres O: Spontaneous transvaginal small bowel tissue according to localization of the defect [16,17]. However, evisceration: A case report. Clinics, 65, 559-561, 2010. DOI: 10.1590/ the pelvic defect repair has been performed simpler in S1807-59322010000500015 cases of pelvic organ prolapse in dogs. In our opinion, 9. Erdemoglu E, Guneyeli İ, Güney M: Abdominal histerektomi sonrası this difference can be related to the body’s posture and vaginal evisceration. J Turk Soc Obstet Gynecol, 2, 149-152, 2011. pelvic organ localization. Pelvic organs are positioned 10. Girgin M, Kanat BH, Ayten R, Cetinkaya Z: Demanslı bir hastada horizontally in dogs but vertically in human body. self-mutilasyona bağlı vaginal evisceration: Bir olgu sunumu. Kafkas Tıp Bil Derg, 3, 106-108, 2013. DOI: 10.5505/kjms.2013.70299 Regarding to this different pelvic position and the need of resistance to gravity, more complex surgical approaches 11. Croak AJ, Gebhart JB, Klingele CJ, Schoreder G, Lee RA, Podratz KC: Characteristics of patients with vaginal rupture and evisceration. Obstet & are inevitable in women with similar disorders. In this Gynecol, 103, 572-576, 2004. DOI: 10.1097/01.AOG.0000115507.26155.45 case, after reposition of ileum and suturing of vaginal wall, 12. Tulleners EP: Avulsion of the jejunum, with vaginal evisceration in a routine abdominal closure technique was performed. cow. J Am Vet Med Assoc, 184, 195-196, 1984. Likewise, no need was seen to use graft in this operation. 13. Tulleners EP, Richardson DW, Reid BV: Vaginal evisceration of the small intestine in three mares. J Am Vet Med Assoc 186, 385-387, 1985. In obstetric injuries, many factors can be determinant 14. Scott PR: Reproductive system. In, Scott PR (Ed): Sheep Medicine. for postoperative prognosis. As previously reported, poor 2nd ed., 45, CRC Press, Taylor & Francis Group; 2015. general condition and shock have negative impact on the 15. Robinson RW: Intestinal prolapse through the vagina in a Beagle. patient’s survival [5]. Despite being severely underweight Vet Med Small Anim Clinic, 73, 1412-1413, 1978. condition in dog was not a problem in this case. In beside 16. Miklos JR, Moore RD, Kohli N: Laparoscopic surgery for pelvic of patient’s condition, some authors pointed that the low support defects. Curr Opin Obstet Gynecol, 14, 387-395, 2002. ambient temperature could be a negatively factor on the 17. Canaz E, Ark HC, Alkış I, Han A, Ölmez H: Pelvik organ prolapsusu: Anatomik temeller ve cerrahi yaklaşım. Jopp Derg, 5, 47-61, 2013. DOI: patient’s prognosis [5,18]. But the dog was referred the our 10.5222/JOPP.2013.047 hospital in a day where the temperature 23 Celsius degrees 18. Mosdol G: Spontoneaus vaginal rupture in pregnant ewes. Vet Rec, averagely in April-2015, therefore no complication related 144, 38-41, 1999. DOI: 10.1136/vr.144.2.38 Kafkas Univ Vet Fak Derg KafKas Universitesi veteriner faKUltesi Dergisi 22 (2): 319-320, 2016 JoUrnal Home-Page: http://vetdergi.kafkas.edu.tr Letter to the Editor DOI: 10.9775/kvfd.2015.14404 online sUbmission: http://vetdergikafkas.org Why Systematic Examination is Important in Diagnosis of Eye Diseases? Lacrimal Punctal Atresia of a Dog Treated When He Reaches the Age of 15 Months (Göz Hastalıklarının Tanısında Sistematik Muayene Neden Önemlidir? Bir Köpekte Ancak 15 Aylık İken Tedavi Edilebilen Atresia Punkta Lakrimalis Olgusu) Sırrı AVKİ 1 Kürşad YİĞİTARSLAN 1 1 Mehmet Akif Ersoy University, Faculty of Veterinary Medicine, Department of Surgery, TR-15030 Burdur - TURKEY Article Code: KVFD-2015-14404 Published Online: 01.10.2015 Dear Editor, A 15 months old male Golden Retriever dog was brought to the MAKU Animal Hospital on October 2013 with complaint “Punctal atresia” or “imperforate lacrimal puncta” is the most of chronic epiphora in right æeye. As it was learned from frequently diagnosed congenital anomaly of canine nasolacrimal the patient’s story, the complaint was present since he born, drainage system. The most affected breeds are American Cocker and treatment attempts of 3 different veterinarians (1: Spaniels, Bedlington Terriers, Golden Retrievers, Poodles and conjunctivitis follicularis; 2: allergic conjunctivitis and 3: bacterial Samoyeds. It can affect the superior, inferior, or both puncta, conjunctivitis) give any improvement. The overall health status and it may be either unilateral or bilateral. Although superior was good on physical examination but constant tear drainage (upper) punctal atresia is asymptomatic, a dramatic epiphora over medial cantus and a strip of dark brown colored hair on is present in inferior (lower) punctal atresia. The diagnosis is this area (Fig. 1A) was obvious. Any inflammatory changes confirmed by detailed observation with a magnifying loupe were recorded neither in cornea nor conjunctiva. The main or operating microscope, nasolacrimal duct cannulation and Schirmer test value of the affected eye was 17.8 mm/min and Jones test (appearance of fluorescein stain in nasal punctum signs such as blepharospasm, photophobia or ocular pain were after dropped into ipsilateral eye). In most cases atresia consists absent. During the observations with a magnifying loupe, the of a layer of conjunctiva over the punctal lumen, therefore absence of inferior lacrimal puncta was noticed (Fig. 1B). With nasolacrimal flushing through the upper punctum with a gentle pressure will cause the conjunctiva over the lower canaliculus the negative result in Jones test with 2% fluorescein stain, the to bulge. Surgical excision of this ballooning conjunctiva and case was diagnosed as right inferior lacrimal punctal atresia. cannulating the canaliculi to assure a patent duct during healing The dog was anesthetized to reestablish tear inflow of are main steps of treatment [1-3]. the congenitally occluded puncta surgically. Nasolacrimal Fig 1. Appearances of (A) the strip of dark brown colored hair (red arrow) on medial cantus of right eye due to epiphora and (B) aplasia of lower lacrimal puncta (green arrow) Şekil 1. (A) Medial kantus tüylerinin, epiforaya bağlı olarak şerit şeklinde koyu kahverengi bir renk alması (kırmızı ok) ve (B) aplazik alt punkta lakrimalisin (yeşil ok) görünüşü  İletişim (Correspondence)  +90 248 2132102  sirriavki@hotmail.com 320 Why Systematic Examination is ... Fig 2. Appearances of (A) nasolacrimal flush performed through the superior lacrimal punctum results with ballooning of the conjunctiva over the punctal atresia (green arrow); (B) circularly excised ballooning conjunctiva (blue arrow); (C) catheterized excision entrance with a silicon tube (black arrow); (D) tip of silicon tube passed through ductus nasolacrimalis and reached to nasal puncta (red arrow) and (E) upper end of silicon catheter bend and sutured over the margin of lower eyelid Şekil 2. (A) Üst puncta lakrimalis’ten yapılan lavajın atrezik puncta üzerindeki konjunktivada yol açtığı balonlaşma (yeşil ok); (B) balonlaşan konjunktivanın sirküler eksizyonu (mavi ok); (C) silikon bir kateter ile yerleştirilen eksizyon girişi (siyah ok); (D) ductus nazolakrimalisten ilerletilen ve puncta nazalise ulaşan (kırmızı ok) silikon kateterin ucu ve (E) alt göz kapağı kenarına bükülerek dikilen silikon kataterin görünüşleri Fig 3. Appearances of (A) Jones test with 2% fluorescein resulted in staining nasal puncta and (B) disappeared discoloration of medial cantus hair Şekil 3. (A) %2’lik fluorescein ile ya- pılan Jones testinde punkta nazalisin boyanması ve (B) medial kantus tüy- lerinde ortadan kalkan renk değişik- liğinin görünüşleri flush was performed through the upper lacrimal punctum via The adventure of this dog since birth with his right eye an 18 gauge angiocat and saline solution. Upon the positive teaches our colleagues 3 important lessons: 1- A complete pressure of injected saline solution, a slight ballooning of the or systematical examination is important in diagnosis of eye conjunctiva over the punctal atresia was observed (Fig. 2A). diseases. Otherwise we may overlook a simple disorder and The ballooning conjunctiva was circularly excised with a fine waste time with wrong therapies. 2- Puppies with chronic tear scissors (Fig. 2B). A silicon catheter was inserted through the discharge but any ocular inflammation must be controlled for excision entrance and advanced until the tip was appears in nasolacrimal drainage system anomalies. 3- Jones test seems right nasal puncta (Fig. 2C-D). The upper end of silicon catheter to be an efficacious tool for nasolacrimal duct patency. was bend over the margin of lower eyelid and sutured with 3 simple sutures parallel to eyelashes (Fig. 2E). The affected eye REFERENCES was then treated with a topical antibiotic solution for 7 days. An Elizabeth collar was applied to ensure the inserted catheter in 1. Avki S: Oftalmik muayene ve tanı. In, Sırrı Avki (Ed): Temel Veteriner Oftalmoloji. 3-45, Medipres Yayıncılık, Malatya, 2012. place for 3 weeks. After 3 weeks the catheter was removed and 2. Avki S: Köpeklerde gözyaşı ve nazolakrimal sistemlerinin hastalık ve the patency of nasolacrimal duct was controlled periodically. operasyonları. In, Sırrı Avki (Ed): Temel Veteriner Oftalmoloji. 107-130, In controls following 1.5 years the opening of lower canaliculi Medipres Yayıncılık, Malatya, 2012. was intact, Jones test was positive (Fig. 3A), and discoloration 3. Slatter DH: Fundamentals of Veterinary Ophtalmology. 323-346, WB in medial cantus hair was disappeared (Fig. 3B). Saunders Company, Philadelphia, 1981. YAZAR İNDEKSİ için tıklayınız YAZIM KURALLARI 1- Yılda 6 (Altı) sayı olarak yayımlanan Kafkas Üniversitesi Veteriner Fakültesi Dergisi’nde (Kısaltılmış adı: Kafkas Univ Vet Fak Derg) Veteriner Hekimlik ve Hayvancılıkla ilgili (klinik ve paraklinik bilimler, hayvancılıkla ilgili biyolojik ve temel bilimler, zoonozlar ve halk sağlığı, hayvan besleme ve beslenme hastalıkları, hayvan yetiştiriciliği ve genetik, hayvansal orijinli gıda hijyeni ve teknolojisi, egzotik hayvan bilimi) orijinal araştırma, kısa bildiri, ön rapor, gözlem, editöre mektup ve derleme türünde yazılar yayımlanır. Dergide yayımlanmak üzere gönderilen makaleler Türkçe, İngilizce veya Almanca dillerinden biri ile yazılmış olmalıdır. 2- Dergide yayımlanması istenen yazılar Times New Roman yazı tipi ve 12 punto ile A4 formatında, 1.5 satır aralıklı ve sayfa kenar boşlukları 2.5 cm olacak şekilde hazırlanmalı ve şekil ve tablo gibi görsel öğelerin metin içindeki yerlerine Türkçe ve yabancı dilde adları ve gerekli açıklamaları mutlaka yazılmalıdır. Dergiye gönderilecek makale ve ekleri (şekil vs) http://vetdergi.kafkas.edu.tr adresindeki online makale gönderme sistemi kullanılarak yapılmalıdır. Başvuru sırasında yazarlar yazıda yer alacak şekilleri online makale gönderme sistemine yüklemelidirler. Yazının kabul edilmesi durumunda tüm yazarlarca imzalanmış Telif Hakkı Devir Sözleşmesi editörlüğe gönderilmelidir. 3- Yazarlar yayınlamak istedikleri makale ile ilgili olarak gerekli olan etik kurulu onayı aldıkları kurumu ve onay numarasını Materyal ve Metot bölümünde belirtmelidirler. Yayın kurulu gerekli gördüğünde etik kurul onay belgesini ayrıca isteyebilir. 4- Makale Türleri Orijinal Araştırma Makaleleri, yeterli bilimsel inceleme, gözlem ve deneylere dayanarak bir sonuca ulaşan orijinal ve özgün çalışmalardır. Türkçe yazılmış makaleler Türkçe başlık, Türkçe özet ve anahtar sözcükler, yabancı dilde başlık, yabancı dilde özet ve anahtar sözcükler, Giriş, Materyal ve Metot, Bulgular, Tartışma ve Sonuç ile Kaynaklar bölümlerinden oluşur ve toplam (metin, tablo, şekil vs dahil) 12 sayfayı geçemez. Yabancı dilde yazılmış makaleler yabancı dilde başlık, yabancı dilde özet ve anahtar sözcükler, Türkçe başlık, Türkçe özet ve anahtar sözcükler dışında Türkçe makale yazım kurallarında belirtilen diğer bölümlerden oluşur. Türkçe ve yabancı dilde özetlerin her biri yaklaşık 200±20 sözcükten oluşmalıdır. Kısa Bildiri, konu ile ilgili yeni bilgi ve bulguların bildirildiği fakat orijinal araştırma olarak sunulamayacak kadar kısa olan yazılardır. Kısa bildiriler, orijinal araştırma makalesi formatında olmalı, fakat özetlerin her biri 100 sözcüğü aşmamalı, referans sayısı 15’in altında olmalı ve 6 sayfayı aşmamalıdır. Ayrıca, en fazla 4 şekil veya tablo içermelidir. Ön Rapor, kısmen tamamlanmış, yorumlanabilecek aşamaya gelmiş orijinal bir araştırmanın kısa (en çok 4 sayfa) anlatımıdır. Bunlar orijinal araştırma makalesi formatında yazılmalıdır. Gözlem (Olgu Sunumu), uygulama, klinik veya laboratuar alanlarında ender olarak rastlanılan olguların sunulduğu makalelerdir. Bu yazıların başlık ve özetleri orijinal makale formatında yazılmalı, bundan sonraki bölümleri Giriş, Olgunun Tanımı, Tartışma ve Sonuç ile Kaynaklar bölümlerinden oluşmalı ve 4 sayfayı geçmemelidir. Editöre Mektup, bilimsel veya pratik yararı olan bir konunun veya ilginç bir olgunun resimli ve kısa sunumudur ve 2 sayfayı geçmemelidir. Derleme, güncel ve önemli bir konuyu, yazarın kendi görüş ve araştırmalarından elde ettiği bulguların da değerlendirildiği özgün yazılardır. Bu yazıların başlık ve özet bölümleri orijinal araştırma makalesi formatında yazılmalı, bundan sonraki bölümleri Giriş, Metin, Sonuç ve Kaynaklar bölümlerinden oluşmalı ve 12 sayfayı geçmemelidir. 5- Makale ile ilgili gerek görülen açıklayıcı bilgiler (tez, proje, destekleyen kuruluş vs) makale başlığının sonuna üst simge olarak işaret konularak makale başlığı altında italik yazıyla belirtilmelidir. 6- Kaynaklar, metin içinde ilk verilenden başlanarak numara almalı ve metin içindeki kaynağın atıf yapıldığı yerde parantez içinde yazılmalıdır. Kaynak dergi ise, yazarların soyadları ve ilk adlarının başharfleri, makale adı, dergi adı (orijinal kısa ad), cilt ve sayı numarası, sayfa numarası ve yıl sıralamasına göre olmalı ve aşağıdaki örnekte belirtilen karakterler dikkate alınarak yazılmalıdır. Örnek: Gokce E, Erdogan HM: An epidemiological study on neonatal lamb health. Kafkas Univ Vet Fak Derg, 15 (2): 225-236, 2009. Kaynak kitap ise yazarların soyadları ile adlarının ilk harfleri, eserin adı, baskı sayısı, sayfa numarası, basımevi, basım yeri ve basım yılı olarak yazılmalıdır. Editörlü ve çok yazarlı olarak yayınlanan kitaptan bir bölüm kaynak olarak kullanılmışsa, bölüm yazarları, bölüm adı, editör(ler), kitap adı, baskı sayısı, sayfa numarası, basımevi, basım yeri ve basım yılı sırası dikkate alınarak aşağıdaki örneğe göre yazılmalıdır. Örnek: Mcllwraith CW: Disease of joints, tendons, ligaments, and related structures. In, Stashak TS (Ed): Adam’s Lameness in Horses. 4th ed., 339-447, Lea and Febiger, Philadelphia, 1988. DOI numarası bulunan kaynaklarda bu bilgi ilgili kaynak künyesinin sonuna eklenmelidir. Online olarak ulaşılan kaynaklarda web adresi ve erişim tarihi, kaynak bilgilerinin sonuna eklenmelidir. Diğer kaynakların yazımında bilimsel yayın ilkelerine uyulmalıdır. Kaynak listesinde “et al.” ve “ve ark.” gibi kısaltmalar yapılmaz. 7- Bakteri, virus, parazit ve mantar tür isimleri ve anatomik terimler gibi latince ifadeler orijinal şekliyle ve italik karakterle yazılmalıdır. 8- Editörlük, dergiye gönderilen yazılar üzerinde gerekli görülen kısaltma ve düzeltmeleri yapabileceği gibi önerilerini yazarlara iletebilir. Yazarlar, düzeltilmek üzere yollanan yazıları online sistemde belirtilen sürede gerekli düzeltmeleri yaparak editörlüğe iade etmelidirler. Editörlükçe ön incelemesi yapılan ve değerlendirmeye alınması uygun görülen makaleler ilgili bilim dalından bir alan editörü ve iki raportörün olumlu görüşü alındığı takdirde yayımlanır. 9- Yayınlanan yazılardan dolayı doğabilecek her türlü sorumluluk yazarlara aittir. 10- Yazarlara telif ücreti ödenmez. 11- Resim ve baskı masrafları için yazarlardan ücret alınır. Ücret bilgileri http://vetdergi.kafkas.edu.tr/ adresinden öğrenilebilir. 12- Yazarlara 50 adet ayrı baskı ücretsiz olarak yollanır. INSTRUCTIONS FOR AUTHORS 1- The Journal of the Faculty of Veterinary Medicine, University of Kafkas (abbreviated title: Kafkas Univ Vet Fak Derg), published bi-monthly, covers original papers, short communication and preliminary scientific reports, case reports, observation, letter to the editor, and review and on all aspects of veterinary medicine and animal science (clinical and paraclinical sciences, biological and basic sciences, zoonoses and public health, animal feeding and nutritional diseases, animal breeding and genetics, hygiene and technology of food from animal sources, exotic animal science). Manuscripts submitted for publication should be written in Turkish, English or German. 2- The manuscripts submitted for publication should be prepared in the format of Times New Roman style, font size 12, A4 paper size, 1.5 line spacing and 2.5 cm margins of all edges. The legend or caption of all illustrations such as figure and table must clearly be written in both Turkish and foreign language and their appropriate position should be indicated in the text. The manuscript and its supplementary (figure etc.) should be submitted by using online manuscript submission system at the address of http://vetdergi.kafkas.edu.tr/ During the submission, the authors should upload the figures of the manuscript to the online manuscript submission system. If the manuscript is accepted for publication, the copyright transfer agreement form signed by all the authors should be send to the editorial office. 3- Authors should indicate the name of institute approves the necessary ethical commission report and the serial number of the approval in the material and methods section. If necessary, editorial board may also request the official document of the ethical commission report. 4- Original (full-length) Manuscripts are original and proper scientific papers based on sufficient scientific investigations, observations and experiments. Manuscripts consist of the title, abstract and keywords, Introduction, Material and Methods, Results, Discussion, and References and it should not exceed 12 pages including text, tables and illustrations. Abstracts should contain 200±20 words. Short Communication Manuscripts contain recent information and findings in the related topics; however, they are written with insufficient length to be a full-length original article. They should be prepared in the format of full-length original article but each of the abstracts should not exceed 100 words, the reference numbers should not exceed 15 and the length of the text should be no longer than 6 pages. Additionally, they should not contain more than 4 figures or tables. Preliminary Scientific Reports are short description (maximum 4 pages) of partially completed original research findings at interpretable level. These should be prepared in the format of full-length original articles. Case Reports describe rare significant findings encountered in the application, clinic and laboratory of related fields. The title and summary of these articles should be written in the format of full-length original articles and the remaining sections should follow Introduction, Case History, Discussion and References without exceeding the total of 4 pages. Letters to the Editor are short and picture-documented presentations of subjects with scientific or practical benefits or interesting cases without exceeding 2 pages. Reviews are original manuscripts gather the literature on current and significant subject along with the commentary and findings of the author on the particular subject. The title and summary of this manuscript should be prepared as described for the full-length original articles and the remaining sections should follow Introduction, Text, Conclusion, and References without exceeding 12 page. 5- The necessary descriptive information (thesis, projects, financial supports etc) scripted as an italic font style should be explained below the manuscript title after placing a superscript mark at the end of title. 6- References should be listed with numerical order as they appear in the text and the reference number should be indicated inside the parentheses at the cited text place. References should have the order of surnames and initial letters of the authors, title of the article, title of the journal (original abbreviated title), volume and issue numbers, page numbers and the year of publication and the text formatting should be performed as shown in the example below. Example: Gokce E, Erdogan HM: An epidemiological study on neonatal lamb health. Kafkas Univ Vet Fak Derg, 15 (2): 225-236, 2009. If the reference is a book, it should follow surnames and initial letters of the authors, title of the book, edition number, page numbers, name and location of publisher and year of publication. If a chapter in book with an editor and several authors is used, names of chapter authors, name of chapter, editors, name of book, edition number, page numbers, name and location of publisher and year of publication and the formatting should be performed as shown in the example below. Example: Mcllwraith CW: Disease of joints, tendons, ligaments, and related structures. In, Stashak TS (Ed): Adam’s Lameness in Horses. 4th ed. ,339-447, Lea and Febiger, Philadelphia, 1988. DOI number should be added to the end of the reference. In the references can be reached online only, the web address and connection date should be added at the end of the reference information. The generally accepted scientific writing instructions must be complied with the other references. Abbreviations, such as “et al” and “and friends” should not be used in the list of the references. 7- The Latin expression such as species names of bacterium, virus, parasite and fungus and anatomical terms must be written in italic character keeping their original forms. 8- The editorial board has the right to perform necessary modifications and reduction on the manuscript submitted for publication and to express recommendations to the authors. The manuscripts sent to authors for correction should be returned to the editorial office within a month. After pre-evaluation and agreement of the submitted manuscripts by editorial board, the article can only be published after the approval of the field editor and two referees specialized in the particular field. 9- All responsibilities from published articles merely belong to the authors. 10- There is no copyright fee for the authors. 11- A fee is charged from the authors to cover printing cost and other expenses. This payment information can be found at http://vetdergi. kafkas.edu.tr/ 12- Reprints (in multiples of 50) of the article are sent to the authors for free.