Hepat Mon. 2018 January; 18(1):e12472. doi: 10.5812/hepatmon.12472.
Published online 2018 January 24. Research Article
Molecular Characterization of Drug Resistance in Hepatitis B Viruses
Isolated from Patients with Chronical Infection in Turkey
Ali Asan,1, * Murat Sayan,2,3 Sila Akhan,4 Suda Tekin Koruk,5 Bilgehan Aygen,6 Fatma Sirmatel,7 Haluk Eraksoy,8 Nazan Tuna,9 Sukran
Köse,10 Ali Kaya,11 Necla Eren Tulek,12 Nazlim Aktug Demir,13 Resit Mistik,14 Bahar Ormen,15 Fatime Korkmaz,16 Taner Yildirmak,17 Onur
Ural,13 Mehtap Aydin,18 Huseyin Turgut,19 Ozgur Gunal,20 and Nese Demirturk21
1 Department of Infectious Diseases and Clinical Microbiology, Bursa Yuksek Ihtisas Training and Research Hospital, Bursa, Turkey
2 Kocaeli University Faculty of Medicine, PCR Unit, Clinical Laboratory, Kocaeli, Turkey
3 Research Center of Experimental Health Sciences, Near East University, Nicosia, Northern Cyprus
4 Department of Infectious Diseases and Clinical Microbiology, Kocaeli University Faculty of Medicine, Kocaeli, Turkey
5 Department of Infectious Diseases and Clinical Microbiology, Koc University Faculty of Medicine, Istanbul, Turkey
6 Department of Infectious Diseases and Clinical Microbiology, Erciyes University Faculty of Medicine, Kayseri, Turkey
7 Department of Infectious Diseases and Clinical Microbiology, Abant Izzet Baysal University Faculty of Medicine, Bolu, Turkey
8 Department of Infectious Disease and Clinical Microbiology, Istanbul Faculty of Medicine, Istanbul University, Istanbul, Turkey
9 Department of Infectious Diseases and Clinical Microbiology, Sakarya University Faculty of Medicine, Sakarya, Turkey
10 Department of Infectious Diseases and Clinical Microbiology, Tepecik Training and Research Hospital, Izmir, Turkey
11 Department of Infectious Diseases and Clinical Microbiology, Mersin University Faculty of Medicine, Mersin, Turkey
12 Department of Infectious Diseases and Clinical Microbiology, Ankara Training and Research Hospital, Ankara, Turkey
13 Department of Infectious Diseases and Clinical Microbiology, Selcuk University Faculty of Medicine, Konya, Turkey
14 Department of Infectious Diseases and Clinical Microbiology, Uludag University Faculty of Medicine, Bursa, Turkey
15 Department of Infectious Diseases and Clinical Microbiology, Izmir Katip Celebi University Atatürk Training and Research Hospital, Izmir, Turkey
16 Department of Infectious Diseases and Clinical Microbiology, Konya Training and Research Hospital, Konya, Turkey
17 Department of Infectious Diseases and Clinical Microbiology, Okmeydani Training and Research Hospital, Istanbul, Turkey
18 Department of Infectious Disease and Clinical Microbiology, Baskent University Faculty of Medicine, Istanbul, Turkey
19 Department of Infectious Diseases and Clinical Microbiology, Pamukkale University Faculty of Medicine, Denizli, Turkey
20 Department of Infectious Diseases and Clinical Microbiology, Samsun Training and Research Hospital, Samsun, Turkey
21 Department of Infectious Diseases and Clinical Microbiology, Kocatepe University Faculty of Medicine, Afyon, Turkey
*Corresponding author: Ali Asan, Mimar Sinan Mah, Emniyet Cad, Polis Okulu Karsisi, Yildirim, Bursa 16310, Turkey. Tel: +90-5332401067, Fax: +90-2246003498, E-mail: draasan@yahoo.com
Received 2017 May 03; Revised 2017 November 10; Accepted 2017 December 28.
Abstract
Background: Hepatitis B virus (HBV) has a high mutation rate due to its unusual replication strategy leading to the production of
a large number of virions with single and double mutations. The mutations, in turn, are associated with the development of drug
resistance to nucleos(t)ide analogs (NUCs) in patients before and during NUCs therapy.
Objectives: The current study aimed at investigating the molecular characterization of HBV in Turkish patients with chronic hep-
atitis B (CHB) infection.
Methods: Polymerase chain reaction (PCR) amplification and direct sequencing procedures were used to analyze mutations. The de-
tected drug resistance mutations were divided into the nucleos(t)ide analogs primary, partial, and compensatory resistance groups.
The amino acid substitutions of hepatitis B surface antigen (HBsAg) were categorized into antiviral drug - associated potential vac-
cine - escape mutations (ADAPVEMs) and typical HBsAg amino acid substitutions, which included hepatitis B hyperimmunoglobulin
(HBIg) - selected escape mutation, vaccine escape mutation, hepatitis B misdiagnosis, and immune - selected amino acid substitu-
tions.
Results: The number of patients included in the study was 528 out of which 271 (51.3%) were treatment - naive and 351 (66.3%) were
hepatitis B e antigen (HBeAg) - negative. Moreover, 325 (61.6%) were males with a mean age of 38 years (range: 18 - 69). Primary,
partial, and compensatory resistance to NUCs was reported in 174 (32.9%) patients. Six different ADAPVEM motifs were determined
in both treatment - naive and treatment - experienced patients, namely, sF161L/rtI169X, sE164D/rtV173L, sL172L/rtA181T, sL173F/rtA181V,
sS195M/rtM204V, and sS196L/rtM204I. The prevalence of ADAPVEMs and typical HBsAg escape mutations was 5.3% (n = 28) and 34.8%
(n = 184), respectively.
Conclusions: The analysis of drug resistance should constitute a fundamental part of the follow - up period of patients with CHB
undergone treatment with NUCs. The surveillance of development of drug resistance mutations, while receiving treatment for
hepatitis B is of paramount importance to monitor and control the emerging resistance.
Keywords: Hepatitis B Virus, Sequence Analysis, HBsAg, Antiviral Drug Resistance, Chronic Hepatitis B, HBV Polymerase
1. Background bases with 4 overlapping open reading frames (ORFs) (1).
The 4 ORFs are the core/precore, polymerase (pol), enve-
Hepatitis B virus (HBV) is a prototype member of the lope (env), and X. The circular nature of the DNA and the
family Hepadnaviridae. It consists of a partially double arrangement of the ORFs cause the env gene to completely
- stranded circular DNA genome of approximately 3200
Copyright © 2018, Hepatitis Monthly. This is an open-access article distributed under the terms of the Creative Commons Attribution-NonCommercial 4.0 International
License (http://creativecommons.org/licenses/by-nc/4.0/) which permits copy and redistribute the material just in noncommercial usages, provided the original work is
properly cited.
Asan A et al.
overlap with the pol gene, and consequently result in im- clinical research ethics committee of Kocaeli University
portant changes in hepatitis B surface antigen (HBsAg) and (Project no. KKAEK 2009/24; date: November 24, 2009; ap-
a considerable reduction in HBsAg - specific antibodies proval no. 5/16), and written informed consent was ob-
(anti - HBs) binding in vitro (2). tained from each patient before entering the study. Blood
The high magnitude of HBV replication leads to the samples were obtained before starting the therapy and
considerable production of virions (> 1012) during each during the viral breakthrough of the treatment. The sam-
replicative cycle of the virus. As the reverse transcriptase ples were centrifuged immediately, and the sera were sep-
(rt) encoded by the pol gene lacks a proofreading activity, arated, aliquoted, and then, stored at - 20°C until use. Sero-
HBV replication is associated with a high mutation rate of logical markers of HBV were measured by enzyme - linked
10 -5 substitutions/base/cycle. This results in the generation immunosorbent assay (ELISA) in all local clinic units.
of all possible single - base changes in the genome, includ-
ing single and double mutations, which in turn are respon-
sible to develop nucleos(t)ide analogs (NUCs) resistance in 2.2. HBV DNA Detection
patients before and during NUCs therapy (3).
The NUCs treatment strategies should be implemented HBV DNA was isolated from the serum samples ob-
as early as possible following the detection of drug - re- tained from the patients on the BioRobot workstation us-
sistant HBV variants, especially before the virological and ing the magnetic particle technology (QIAsymphony SP;
clinical breakthrough (4). Mutations may occur primary Qiagen GmbH, Hilden, Germany). HBV DNA was detected
and secondary forms. Primary drug resistance mutations by a commercial real - time polymerase chain reaction
tend to reduce the susceptibility to an antiviral agent. (PCR) assay (Artus HBV QS - RGQ test; Qiagen GmbH, Hilden,
However, secondary compensatory mutations repair repli- Germany) on the real - time platform (Rotor - Gene Q; Qia-
cation defects related to primary drug resistance (5). gen GmbH, Hilden, Germany).
Turkey is one of the countries with a prevalence of 2%
to 8% of intermediate endemicity for HBV infecion (6, 7).
In a systematic review in Turkey, the estimated overall pop- 2.3. HBV pol Gene Sequencing
ulation with HBV prevalence was 4.57%, whereas the esti-
mated total number of patients with chronic hepatitis B Specific primer pairs were constructed (forward:
(CHB) was 3.3 million. However, the prevalence varied in 5’ - TCGTGGTGGACTTCTCTCAATT - 3’ and reverse: 5, -
different regions of the country; the prevalence was 3.47% CGTTGACAGACTTTCCAATCAAT - 3’) for the amplification
and 6.72% in the Western and Eastern regions, respectively of the HBV pol gene region (11). The PCR conditions were
(8, 9). as follows: denaturation at 95°C for 10 minutes followed
With this background, the current study aimed at in- by 35 cycles consisting of an annealing step at 95°C for
vestigating the molecular characterization of HBV in Turk- 45 seconds, extension at 60°C for 45 seconds, and a final
ish patients with CHB. step at 72°C for 45 seconds. The final concentration of the
primers was 0.3 mM. The size of the derived amplicon in
HBV was approximately 742 bp and included all the known
2. Methods NUCs resistance mutations in HBV. Phire Hot Start DNA
polymerase (Finnzymes Oy, Vantaa, Finland) was utilized
2.1. Patients in the sequencing protocol. All PCR products were purified
The current study was conducted from 2010 to 2015 on using the High Pure PCR product purification kit (Roche
762 patients chronically infected with HBV from 7 regions Diagnostics, Mannheim, Germany). Sequencing was per-
and 35 clinics in 25 cities across Turkey. Due to the un- formed using an ABI PRISM 3130 genetic analyzer (applied
successful DNA sequencing reactions, 110 and 124 patients biosystems Inc., Foster City, California, United States). The
in the treatment - naive and treatment - experienced cat- BigDye Terminator version 3.1 Cycle Sequencing Kit (Amer-
egories were excluded from the study, respectively. The sham Pharmacia Biotech Inc., Piscataway, New Jersey,
clinical and demographic characteristics of the patients United States), 36 cm capillary array, and POP - 7TM polymer
are mentioned in Table 1. The study consisted of 528 pa- (applied biosystems Inc.) were used for sequencing. For
tients, treatment - naive (n = 271, 51.3%) and those under cycle sequencing, the following thermal protocol was
NUCs treatment (n = 257, 48.7%). All the patients were clas- used: 35 cycles consisting of 95°C for 20 seconds, 50°C for
sified as HBV chronic carriers according to the European 25 seconds, and finally 60°C for 2 minutes. The reverse and
Association for the Study of the Liver (EASL) clinical prac- sequencing primers were used at a final concentration of
tice guidelines (10). The study was also approved by the 0.5 mM.
2 Hepat Mon. 2018; 18(1):e12472.
Asan A et al.
2.4. HBV pol/surface Gene Mutation Determination HBeAg positivity in these groups was detected in 65 pa-
The sequencing data were analyzed using the tients (24.0%) and 113 patients (44.0%) (P = 0.01), respec-
Genafor/Arevir - geno2pheno drug resistance tool (cen- tively.
ter of advanced European studies and research; Bonn, The patients in the treatment - naive and treatment
Germany [http://coreceptor. bioinf.mpi - inf.mpg.de]). - experienced groups reported a mean ± standard devia-
The geno2pheno tool for HBV is a database specifically tion (SD) age of 39.32 ± 11.47 and 38.38 ± 12.72 years, mean
designed for the rapid computer - assisted virtual pheno- HBV viral load of 8.5 + E7 (± 6.6 + E8) and 6.2 + E7 (± 6.5
typing of Hepatitis B and utilizes genome (nucleic acid) + E9) IU/mL, mean alanine aminotransferase (ALT) levels
sequences as input. The program searches for homology of 69.99 ± 199.84 and 73.68 ± 107.92 U/L, and mean aspar-
between the input sequence and other DNA sequences tate transaminase (AST) levels of 51.01 ± 110.44 and 50.18
already stored in its database, including relevant clinical ± 60.12 U/L, respectively. The differences in age, HBV viral
data for drug resistance and surface gene mutations (12). load, ALT, and AST levels in the patients in the treatment -
The tool searches for HBV drug resistance mutations in naive and treatment - experienced groups were not signifi-
the rt domain of the polymerase at amino acid positions cant according to t test results (P = 0.43, 0.71, 0.81, and 0.92,
80 to 250 (13). Drug resistance mutations to the NUCs respectively).
were categorized into primary, partial, and compensatory Among 50 (18.5%) and 112 (43.6%) patients in the treat-
resistance groups (14). ment - naive and treatment - experienced groups, respec-
The overlapping S - gene segment was obtained using tively, there were 191 (70.5%) and 142 (55.3%) patients in
the geno2pheno tool for amino acid substitutions at po- HBeAg - negative CHB phase and immune - reactive phase,
sitions from 100 to 196 (15). The amino acid substitutions respectively (P = 0.01).
in HBsAg were categorized into antiviral drug - associated The patients were administered lamivudine (LAM,
potential vaccine - escape mutants (ADAPVEMs) and typical 33.5%), combination therapy (27.6%), tenofovir (TDF, 14.0%),
HBsAg amino acid substitutions. The latter included hep- entecavir (ETV, 11.7%), PEGylated interferon (5.4%), telbivu-
atitis B hyperimmunoglobulin (HBIg) - selected escape mu- dine (Ldt) (3.9%), and adefovir (ADV, 3.9%) at the time of viral
tation, vaccine escape mutation, hepatitis B misdiagnosis, rebound in the treatment - experienced group.
and immune - selected amino acid substitutions (5, 14, 16- Genotype D was identified in 526 patients (99.6%), and
19). genotype H only in 2 naive patients (0.4%) (Table 1). How-
Some mutations, especially ADAPVEMs, were not lo- ever, subgenotypes D1, D2, D3, and D4 were determined in
cated in the “a” determinant of the HBsAg protein. Further, 461 (87.3%), 29 (5.5%), 30 (5.7%), and 6 (1.1%) patients, respec-
the important neutralizing domains of the HBsAg protein tively.
including the region outside the “a” determinant of the In total, 174 (32.9%) Turkish patients with mutations in
HBsAg protein for ADAPVEMs were analyzed. the HBV pol gene were primary, partial, or compensatory
resistant to NUCs. Among them, 79 (45.4%) patients be-
2.5. Statistical Analysis longed to the treatment - naive group, whereas 95 (54.6%)
belonged to the treatment - experienced group. The preva-
Statistical analysis was performed using IBM SPSS lence of the mutation in the gene encoding HBV poly-
Statistics software, version 21.0 for Windows (SPSS; IBM cor- merase in the treatment - experienced patients was statis-
poration, New York, United States). The chi - square and tically different from those of the patients in the treatment
t tests were utilized in the statistical analysis. A P value < - naive group (P = 0.05). The most common primary re-
0.05 was considered significant. sistance mutation both in the treatment - naive and treat-
ment - experienced patients was rtM204I/V ± rtV173L ±
3. Results rtL180M. The frequencies and patterns of mutations in the
HBV pol gene are displayed in Table 2.
The current study consisted of a total of 528 patients, The total prevalence of typical amino acid substitu-
of which 325 (61.6%) were male with a mean age of 38 years tions in HBsAg was 34.8% (n = 184). According to the treat-
(range: 18 - 69). Based on their HBeAg status, 351 (66.3%) pa- ment status, the prevalence was 33.5% (n = 91) and 36.1%
tients were HBeAg - negative. Seven patients were anti - HIV (n = 93) in the treatment - naive and treatment - experi-
antibody positive, 4 were anti - HDV IgG positive, and 1 pa- enced patients, respectively. The HBIg escape mutation,
tient was anti - HCV positive (Table 1). vaccine escape mutation, misdiagnosis, and immune - se-
The number and percentage of male patients in the lected escape mutations were 8.3%, 4.1%, 3.8%, and 18.6%, re-
treatment - naive and treatment - experienced groups were spectively. There was no statistically significant difference
170 (62.7%) and 155 (60.3%) (P = 0.56), respectively. The in the prevalence of HBsAg escape amino acid substitu-
Hepat Mon. 2018; 18(1):e12472. 3
Asan A et al.
Table 1. Clinical and Demographic Characteristics of the Patients
Variables Value
Patients, no 528
Gender, M/F, (%) 325/203 (61.6/38.4)
HBeAg positivity, n (%) 178 (33.7)
ALT,median (range) U/L 37 (9 - 2584)
HBVDNA load,median (range) IU/mL 1.3 E+4 (6 E+2 - 9.8 E+6)
Participation fromRegionsa , n (%)
Marmara (Balikesir, Bursa, Edirne, Istanbul, Kocaeli) 218 (41.3)
Central Anatolia (Ankara, Konya, Kayseri) 104 (19.7)
South - eastern Anatolia (Adiyaman, Batman, Diyarbakir, Antep, Urfa) 73 (13.8)
Black Sea (Bolu, Giresun, Sakarya, Samsun, Tokat) 55 (10.4)
Aegean (Afyon, Denizli, Izmir) 48 (9.1)
Mediterranean (Antalya, Maras, Mersin, Osmaniye) 30 (5.7)
Clinical status, n (%)
HBeAg negative CHB phase 333 (63.1)
Immune reactive phase 162 (30.7)
Inactive HBV carrier state phase 18 (3.4)
Immune tolerant phase 15 (2.8)
HBV genotype, n (%) D: 526 (99.6) ; H: 2 (0.4)
HBV subgenotype of genotype D, n (%) D1: 461 (87.7 ); D2: 29 (5.5); D3: 30 (5.7); D4: 6 (1.1)
Co - infection status, n (%)
Anti - HCV positive 1 (0.2)
Anti - HDV IgG positive 4 (0.8)
Anti - HIV positive 7 (1.3)
Treatment status, n (%)
Treatment - naive 271 (51.3)
Treatment - experienced 257 (48.7)
Drug choice statusb , n(%)
Lamivudine 86 (33.5)
Combination 71 (27.6)
Tenofovir 36 (14.0)
Entecavir 30 (11.7)
Interferon 14 (5.4)
Telbivudin 10 (3.9)
Adefovir 10 (3.9)
Abrrevations: CHB, chronic hepatitis B; F, female; M, male.
aPatients included 35 different clinics from 25 cities in Turkey.
bTherapy situation during rebound.
tions in the treatment - naive and treatment - experienced 3.
patients (P = 0.57). Typical patterns of amino acid substi-
tutions in the HBsAg escape mutants are depicted in Table Six different ADAPVEM motifs were located both in the
treatment - naive and treatment - experienced patients.
4 Hepat Mon. 2018; 18(1):e12472.
Asan A et al.
Table 2. Characteristics of Genotypic Resistance Mutations to the Nucleos(t)ide Analogues
Mutation Characteristic, No. Mutation Pattern Nucleos(t)ide Analogue Patient No. (%) P Value
(%)
Naive Experienced
rtA181G/S/T/V LAM, LdT, L - FMAU, ADV, TDFa 1 (0.18) 8 (1.5)
rtT184A/I/L ETVa 0 9 (1.7)
rtM204I/V ± rtV173L ± rtL180M LAM, LdT, L - FMAU, FTC 9 (1.8) 50 (9.4)
Primary ResistanceMutation
n = 84 (15.9) rtM204V + rtT184S LAM, LdT, ETV 0 1 (0.18)
0.01
rtI233V ADV 3 (0.5) 1 (0.18)
rtN236T ADV, TDF 1 (0.18) 1 (0.18)
Total 14 (2.6) 70 (13.2)
rtT184L ETV 0 1 (0.18)
rtA194S/T/X TDF 4 (0.7) 6 (1.1)
Partial ResistanceMutation
n = 20 (3.7) rtS202G ETV 1 (0.18) 6 (1.1)
0.06
rtM250V/R ETV 1 (0.18) 1 (0.18)
Total 6 (1.1) 14 (2.6)
rtL91I LdT 23 (4.3) 23 (4.3)
rtQ149K ADV 19 (3.5) 15 (2.8)
rtV191I TDF 0 1 (0.18)
CompensatoryMutation n =
143 (27.0) rtV214A LAM, L - FMAU, FTC, TDF 2 (0.3) 3 (0.5)
0.09
rtQ215H/P/S LAM, L - FMAU, FTC, TDF 37 (7) 18 (3.4)
rtN238D ADV 1 (0.18) 1 (0.18)
Total 82 (15.5) 61 (11.5)
aPropable resistance
They were sF161L/rtI169X, sE164D/rtV173L, sL172L/rtA181T, was reported rtM204I/V ± rtV173L ± rtL180M. The preva-
sL173F/rtA181V, sS195M/rtM204V, and sS196L/rtM204I. The to- lence of primary resistance mutations in the treatment -
tal prevalence of ADAPVEMs was 2.9% (n = 8) and 7.7% (n = experienced patients was statistically different from that
20) in the treatment - naive and treatment - experienced of the treatment - naive patients (P = 0.01), indicating that
groups, respectively. The prevalence of ADAPVEMs in the primary resistance mutations occurred mainly in patients
treatment - experienced patients was statistically differ- with the use of NUCs during treatment. The viral rebounds
ent from that of the treatment - naive patients (P = 0.03). during antiviral treatment should be analyzed in terms
The ADAPVEM patterns were related to LAM, LdT, and ADV of drug resistance. Antiviral resistance can be detected
drugs. The ADAPVEMs motifs in the treatment - naive and prior to treatment; therefore, screening to detect resis-
treatment - experienced patients are displayed in Table 4. tance prior to the commencement of treatment may be re-
garded as a rational approach. The primary resistance mu-
tations associated with amino acid positions 181, 204, 233,
4. Discussion and 236 were detected in the treatment - naive patients.
Sayan et al., reported 2 resistance mutations (rtI233V and
The current study focused on analyzing the prevalence rtN236T) associated with acyclic phosphonates (ADV); how-
of mutations in the Turkish people chronically infected ever, the group could not detect YIMM or YMDD mutations
with HBV. Six different primary resistance mutation pat- in patients with naive - CHB in Turkey (11). The current study
terns were detected in 84 (48.2%) patients. Fourteen (8%) of findings suggested a possible accumulation of primary re-
them belonged to the treatment - naive, whereas 70 (40.2%) sistance mutations for NUCs, which may be attributed to
of them belonged to the treatment - experienced group. their widespread use in the last 5 years in Turkey.
However, the most common primary resistance mutation The available literature reports an overall prevalence of
Hepat Mon. 2018; 18(1):e12472. 5
Asan A et al.
Table 3. Typical HBsAG Escape Amino Acid Substitutions of the Study Patients
HBsAg Amino Acid Mutation Pattern Patient No. (%) Combined Pattern Number of P Value
Substitution Patients
Category
Naive Experienced
HBIg escape sT118A, sP120T, 23 (8.4) 21 (8.2) sT123A + sG145K 2a 0.89
sT123A,sQ129R,
sM133L,
sY134N,sD144E,
sG145K
Vaccine escape sP120S, sM133L, 10 (3.7) 12 (4.6) 0.57
sS143L,sD144E,
sG145R, sS193L
Hepatitis B sP120S/T, sR122K, 11 (4) 9 (3.5) 0.73
misdiagnosis sT131I, sM133T, sS143L
sS143T + sD144E + 1a
sG145R
sQ101H/R, sI110L, sI110L + sP120T 2a
sG119I/R,
a
Immune - selected sP120T,T123A/N, sQ101H + sI110L 1
amino acid sP127T, sG130K/R, 47 (17.3) 51 (19.8) a 0.46
substitution sT131N, sT140I, sQ101H + sP127T 1
sS143T, sD144E,
sQ101H + sI110L + 1a
sG145R
P120T
Total 91(33.5) 93 (36.1)
aNumber of combined pattern patients included to the mutation pattern.
Table 4. ADAPVEM according to nucleos(t)ide analogues in treatment naive and experienced patients
Mutation Mutation Pattern Nucleos(t)ide Patient, N (%) P Value
Characteristic Analogue
Treatment - Naive Treatment -
Experienced
sF161L/rtI169X ETV 1 -
sE164D/rtV173L + LAM, LdT - 3
sS195M/rtM204V
ADAPVEMN = 28a (5.3) rtA181T/sL172L ADV - 1
0.03
rtA181V/sL173F ADV - 3
sS195M/rtM204V LAM, LdT 4 7
sS196L/rtM204I LAM, LdT 3 6
Total 8 (2.9) 20 (7.7)
Abbreviation: ADAPVEM, antiviral drug - associated potential vaccine - escape mutant; ADV, adefovir; LAM, lamivudine; LdT, telbivudine.
aSome of the patients had multiple mutations, however the percentage of mutation was calculated for 28 patients.
primary resistance mutations among treatment - naive pa- namely rtM204I/V, was usually found in combination with
tients to range from 1% to 30%. Such variability is likely to other mutation patterns both in the treatment - naive and
occur due to the differences in the methods applied to de- treatment - experienced patients (30). The combination
termine the mutation in the HBV pol gene, overall study status regarding the rtM204V mutation may serve as a use-
design, and study population (20-29). However, Sayan et ful tool when selecting the study methodology.
al., mentioned that the direct sequencing approach could
limit the detection of primary resistance mutations (11). In The current study detected and characterized 4 differ-
the current study, the major primary resistance mutation, ent partial resistance mutations. They were mainly asso-
ciated with ETV (rtT184L, rtS202G, and rtM250R/V). How-
6 Hepat Mon. 2018; 18(1):e12472.
Asan A et al.
ever, in half of the patients, the mutations in ADV gene sP120T, sM133I, sS143L, SD144A/E, sG145R, and sE164D (13, 14,
(rtA194S/T/X) were detected. Patients carrying these muta- 41). Typical HBsAg escape mutations may result as a con-
tions and undergoing a long - term therapy may require sequence of a failure to control infection with vaccination
frequent monitoring for primary drug resistance against or HBIg and misdiagnosis in the HBsAg testing stage (2).
ETV and TDF (31, 32). The national insurance policy cov- Patients with CHB undergoing NUCs treatments should be
ered only LAM, Ldt, and interferons for first - line treatment surveyed for typical HBsAg escape mutations for the bene-
(patients with HBV DNA < 2 E + 6 IU/mL). Until July 2015, fit of public health (30, 41).
the choice of treatment for CHB was limited; therefore, the The determination of viral genotypes assists to analyze
current study did not discuss the type and duration of the the progression of the disease, thereby aid to develop a
therapy. suitable anti - viral therapy. Genotype D is widespread in
The most common compensatory mutations in the Turkey and other Mediterranean countries (41, 42). D1 was
current study were rtQ215H/P/S, rtL91I, and rtQ149K in ei- more frequent with the presence of D1 - D4 subgenotypes in
ther single or combined profiles both in treatment - naive Turkey (43). The determination of genotypes and subgeno-
and treatment - experienced patients. The rtQ215H sub- types of HBV may contribute to accurate data generation
stitution was detected in patients receiving LAM or ADV associated with their circulation and transmissibility.
therapy; however, its virological and clinical importance The coinfection data were very limited in Turkey; the
remained unclear (33). The primary function of compen- coinfection of HBV/HIV, HBV/HDV, and HBV/HDV was 1.3%,
satory mutations is to repair replication defects in viral 0.8%, and 0.2%, respectively. In a single large - scale study,
polymerase activity related to the generation of primary Sayan et al., analyzed 1306 HIV - positive patients and coin-
drug resistance (11, 30, 34). Therefore, compensatory mu- fection of HIV/HBV was 2.7%. Sexual contact was reported
tations can be detected during viral rebound, but without as the acquisition route in 98.6% of the patients, whereas
primary resistance during the NUCs therapy in patients the use of injection drug was only 0.3% (44). Amiri et al.,
with chronic hepatitis B. These, in turn, may assist to dis- reported the coinfection of HBV/HIV as 1.8% and concluded
criminate from primary drug resistance. Compensatory that the use of injection drug severely affected the degree
mutations without any primary or partial resistance muta- of coinfection (45). Both of the references 44 and 45 are re-
tions were detected in 27 patients in the treatment - naive gional (from Turkey and Iran).
and in 59 patients in the treatment - experienced groups. In conclusion, the findings on drug resistance muta-
The substitution mutation, rtQ215, occurred even without tions in the treatment group require rational approaches
exogenous selection pressures (35). such as prevention of unnecessary drug modifications due
In the current study, six different types of ADAPVEMs to compensatory mutations. The increasing incidence of
were determined in Turkish patients with CHB predomi- drug resistance mutations warrants an analysis of drug re-
nantly associated with L - nucleosides (LAM and LdT) and sistance as an integral part to manage patients with CHB
ADV. However, ADAPVEMs were mainly observed in pa- using NUCs. In addition, the surveillance of drug resis-
tients undergoing NUCs therapy (Table 4). The data gath- tance mutations when treating HBV should be regarded
ered in the current study coincided with the findings of as an area of supreme importance both for regional and
other studies (11, 36, 37), particularly, the frequency of global control of CHB.
rtM204I/V + sI195 M/sW196S/L mutations in LAM - resistant
cases demonstrated a predominant presence (34). Thus,
the ADAPVEMs can adversely affect the local or global im- Acknowledgments
munization programs to control HBV with a potential to
spread to individuals vaccinated against HBV infection (18, None declared.
19, 38, 39).
In the HBV genome, the HBV polymerase gene and en-
velope gene completely overlap (40); hence, the mutations References
in the pol ORF can cause alterations in the overlapping HB-
sAg. Typical HBsAg escape mutations were detected in the 1. Miller RH, Kaneko S, Chung CT, Girones R, Purcell RH. Compact orga-
nization of the hepatitis B virus genome. Hepatology. 1989;9(2):322–7.
4 categories of the patients. The immune - selected amino [PubMed: 2643549].
acid substitution category was the most common HBsAg 2. Torresi J, Earnest-Silveira L, Deliyannis G, Edgtton K, Zhuang H, Lo-
amino acid substitution. However, some categories, such carnini SA, et al. Reduced antigenicity of the hepatitis B virus HBsAg
as HBIg escape and immune - selected mutations demon- protein arising as a consequence of sequence changes in the over-
lapping polymerase gene that are selected by lamivudine therapy.
strated certain patterns. Some typical HBsAg escape mu- Virology. 2002;293(2):305–13. doi: 10.1006/viro.2001.1246. [PubMed:
tations, commonly detected in the patients with CHB, are 11886250].
Hepat Mon. 2018; 18(1):e12472. 7
Asan A et al.
3. Colonno RJ, Rose R, Baldick CJ, Levine S, Pokornowski K, Yu CF, et al. En- resistance are rare in treatment-naive patients. Clin Gastroenterol
tecavir resistance is rare in nucleoside naive patients with hepatitis Hepatol. 2014;12(8):1363–70. doi: 10.1016/j.cgh.2013.11.036. [PubMed:
B. Hepatology. 2006;44(6):1656–65. doi: 10.1002/hep.21422. [PubMed: 24342744].
17133475]. 22. Han Y, Huang LH, Liu CM, Yang S, Li J, Lin ZM, et al. Characterization
4. Zoulim F, Perrillo R. Hepatitis B: reflections on the current ap- of hepatitis B virus reverse transcriptase sequences in Chinese treat-
proach to antiviral therapy. J Hepatol. 2008;48 Suppl 1:S2–19. doi: ment naive patients. J Gastroenterol Hepatol. 2009;24(8):1417–23. doi:
10.1016/j.jhep.2008.01.011. [PubMed: 18304680]. 10.1111/j.1440-1746.2009.05864.x. [PubMed: 19486254].
5. Locarnini S. Primary resistance, multidrug resistance, and cross- 23. Jardi R, Rodriguez-Frias F, Buti M, Schaper M, Esteban R, Guardia J.
resistance pathways in HBV as a consequence of treatment fail- Mutations at HBV-polymerase gene associated with entecavir drug
ure. Hepatol Int. 2008;2(2):147–51. doi: 10.1007/s12072-008-9048-3. resistance in patients not undergoing entecavir therapy. Hepatol.
[PubMed: 19669299]. 2006;44:547A.
6. Mistik R. Viral hepatit. In: Tabak, F , Balik, İ , Tekeli, E , editors. 1. Istan- 24. Lampertico P, Viganò M, Facchetti F, Puoti M, Minola E, Suter F, et al.
bul: VHSD; 2007. Turkiye de viral hepatit epidemiyolojisi yayinlarin Effectiveness of entecavir for the treatment of NUC-naive chronic hep-
irdelenmesi, Yayinların irdelenmesi; p. 10–50. atitis B patients: a large multicenter cohort study in clinical practice.
7. Gurol E, Saban C, Oral O, Cigdem A, Armagan A. Trends in hepatitis Hepatol. 2008;48(Suppl 1):707A–8A.
B and hepatitis C virus among blood donors over 16 years in Turkey. 25. Ludwig AD, Goebel T, Adams O, Baumann N, Hauck K, Fey H, et al. Pri-
Eur J Epidemiol. 2006;21(4):299–305. doi: 10.1007/s10654-006-0001-2. mary resistance mutations against nucleos (t) ide analogues in treat-
[PubMed: 16685581]. ment name patients with hbv-infection. Hepatol. 2008;48(4):701A.
8. Tozun N, Ozdogan O, Cakaloglu Y, Idilman R, Karasu Z, Akarca U, 26. Mirandola S, Campagnolo D, Bortoletto G, Franceschini L, Marco-
et al. Seroprevalence of hepatitis B and C virus infections and risk longo M, Alberti A. Large-scale survey of naturally occurring HBV poly-
factors in Turkey: a fieldwork TURHEP study. Clin Microbiol Infect. merase mutations associated with anti-HBV drug resistance in un-
2015;21(11):1020–6. doi: 10.1016/j.cmi.2015.06.028. [PubMed: 26163105]. treated patients with chronic hepatitis B. J ViralHepat. 2011;18(7):212–6.
9. Toy M, Onder FO, Wormann T, Bozdayi AM, Schalm SW, Borsboom doi: 10.1111/j.1365-2893.2011.01435.x. [PubMed: 21692935].
GJ, et al. Age- and region-specific hepatitis B prevalence in Turkey 27. Salpini R, Svicher V, Cento V, Gori C, Bertoli A, Scopelliti F, et al.
estimated using generalized linear mixed models: a systematic re- Characterization of drug-resistance mutations in HBV D-genotype
view. BMC Infect Dis. 2011;11:337. doi: 10.1186/1471-2334-11-337. [PubMed: chronically infected patients, naive to antiviral drugs. Antiviral
22151620]. Res. 2011;92(2):382–5. doi: 10.1016/j.antiviral.2011.08.013. [PubMed:
10. European Association For The Study Of The L. EASL clinical prac- 21920388].
tice guidelines: Management of chronic hepatitis B virus infection. 28. Ergunay K, Kahramanoglu Aksoy E, Simsek H, Alp A, Sener B, Tatar G,
J Hepatol. 2012;57(1):167–85. doi: 10.1016/j.jhep.2012.02.010. [PubMed: et al. [Investigation of baseline antiviral resistance in treatment-naive
22436845]. chronic hepatitis B cases]. Mikrobiyol Bul. 2013;47(4):628–35. [PubMed:
11. Sayan M, Akhan SC, Meric M. Naturally occurring amino-acid substitu- 24237431].
tions to nucleos(t)ide analogues in treatment naive Turkish patients 29. Bartholomeusz A, Locarnini SA. Antiviral drug resistance: clinical
with chronic hepatitis B. J Viral Hepat. 2010;17(1):23–7. doi: 10.1111/j.1365- consequences and molecular aspects. Semin Liver Dis. 2006;26(2):162–
2893.2009.01149.x. [PubMed: 19566788]. 70. doi: 10.1055/s-2006-939758. [PubMed: 16673294].
12. Papatheodoridis GV, Deutsch M. Resistance issues in treat- 30. Sayan M, Akhan SC, Senturk O. Frequency and mutation patterns
ing chronic hepatitis B. Future Microbiol. 2008;3(5):525–38. doi: of resistance in patients with chronic hepatitis B infection treated
10.2217/17460913.3.5.525. [PubMed: 18811237]. with nucleos(t)ide analogs in add-on and switch strategies. Hepat
13. Shaw T, Bartholomeusz A, Locarnini S. HBV drug resistance: mecha- Mon. 2011;11(10):835–42. doi: 10.5812/kowsar.1735143X.775. [PubMed:
nisms, detection and interpretation. J Hepatol. 2006;44(3):593–606. 22224083].
doi: 10.1016/j.jhep.2006.01.001. [PubMed: 16455151]. 31. Liu Y, Wang CM, Cheng J, Liang ZL, Zhong YW, Ren XQ, et al. Hepatitis
14. Sheldon J, Rodes B, Zoulim F, Bartholomeusz A, Soriano V. Muta- B virus in tenofovir-naive Chinese patients with chronic hepatitis B
tions affecting the replication capacity of the hepatitis B virus. contains no mutation of rtA194T conferring a reduced tenofovir sus-
J Viral Hepat. 2006;13(7):427–34. doi: 10.1111/j.1365-2893.2005.00713.x. ceptibility. Chin Med J (Engl). 2009;122(13):1585–6. [PubMed: 19719953].
[PubMed: 16792535]. 32. Xu Y, Zhang YG, Wang X, Qi WQ, Qin SY, Liu ZH, et al. Long-term an-
15. Avellon A, Echevarria JM. Frequency of hepatitis B virus ’a’ deter- tiviral efficacy of entecavir and liver histology improvement in Chi-
minant variants in unselected Spanish chronic carriers. J Med Virol. nese patients with hepatitis B virus-related cirrhosis.World J Gastroen-
2006;78(1):24–36. doi: 10.1002/jmv.20516. [PubMed: 16299725]. terol. 2015;21(25):7869–76. doi: 10.3748/wjg.v21.i25.7869. [PubMed:
16. Locarnini S, Bowden S. Drug resistance in antiviral therapy. Clin 26167087].
Liver Dis. 2010;14(3):439–59. doi: 10.1016/j.cld.2010.05.004. [PubMed: 33. Osiowy C, Villeneuve JP, Heathcote EJ, Giles E, Borlang J. Detection of
20638024]. rtN236T and rtA181V/T mutations associated with resistance to ade-
17. Sheldon J, Soriano V. Hepatitis B virus escape mutants induced fovir dipivoxil in samples from patients with chronic hepatitis B virus
by antiviral therapy. J Antimicrob Chemother. 2008;61(4):766–8. doi: infection by the INNO-LiPA HBV DR line probe assay (version 2). J
10.1093/jac/dkn014. [PubMed: 18218641]. ClinMicrobiol. 2006;44(6):1994–7. doi: 10.1128/JCM.02477-05. [PubMed:
18. Teo CG, Locarnini SA. Potential threat of drug-resistant and vaccine- 16757589].
escape HBV mutants to public health. Antivir Ther. 2010;15(3 Pt B):445– 34. Lok AS, Zoulim F, Locarnini S, Bartholomeusz A, Ghany MG, Pawlot-
9. doi: 10.3851/IMP1556. [PubMed: 20516564]. sky JM, et al. Antiviral drug-resistant HBV: standardization of nomen-
19. Locarnini SA, Yuen L. Molecular genesis of drug-resistant and clature and assays and recommendations for management. Hepatol.
vaccine-escape HBV mutants. Antivir Ther. 2010;15(3 Pt B):451–61. doi: 2007;46(1):254–65. doi: 10.1002/hep.21698. [PubMed: 17596850].
10.3851/IMP1499. [PubMed: 20516565]. 35. Amini-Bavil-Olyaee S, Herbers U, Mohebbi SR, Sabahi F, Zali MR,
20. Sayan M, Cavdar C, Dogan C. Naturally occurring polymerase and Luedde T, et al. Prevalence, viral replication efficiency and an-
surface gene variants of hepatitis B virus in Turkish hemodialysis tiviral drug susceptibility of rtQ215 polymerase mutations within
patients with chronic hepatitis B. Jpn J Infect Dis. 2012;65(6):495–501. the hepatitis B virus genome. J Hepatol. 2009;51(4):647–54. doi:
[PubMed: 23183201]. 10.1016/j.jhep.2009.04.022. [PubMed: 19586679].
21. Vutien P, Trinh HN, Garcia RT, Nguyen HA, Levitt BS, Nguyen K, et 36. Sayan M, Akhan SC. Antiviral drug-associated potential vaccine-
al. Mutations in HBV DNA polymerase associated with nucleos(t)ide
8 Hepat Mon. 2018; 18(1):e12472.
Asan A et al.
escape hepatitis B virus mutants in Turkish patients with chronic hep- of hepatitis B virus surface antigen escape mutations and concomi-
atitis B. Int J Infect Dis. 2011;15(10):722–6. doi: 10.1016/j.ijid.2011.05.019. tantly nucleos(t)ide analog resistance mutations in Turkish patients
[PubMed: 21784687]. with chronic hepatitis B. Int J Infect Dis. 2010;14 Suppl 3:136–41. doi:
37. Warner N, Locarnini S. The antiviral drug selected hepatitis B virus 10.1016/j.ijid.2009.11.039. [PubMed: 20382061].
rtA181T/sW172* mutant has a dominant negative secretion defect and 42. Hadziyannis SJ. Natural history of chronic hepatitis B in Euro-
alters the typical profile of viral rebound. Hepatol. 2008;48(1):88–98. Mediterranean and African countries. J Hepatol. 2011;55(1):183–91. doi:
doi: 10.1002/hep.22295. [PubMed: 18537180]. 10.1016/j.jhep.2010.12.030. [PubMed: 21238520].
38. Clements CJ, Coghlan B, Creati M, Locarnini S, Tedder RS, Torresi J. 43. Sunbul M. Hepatitis B virus genotypes: global distribution and
Global control of hepatitis B virus: does treatment-induced antigenic clinical importance. World J Gastroenterol. 2014;20(18):5427–34. doi:
change affect immunization?. Bull World Health Organ. 2010;88(1):66– 10.3748/wjg.v20.i18.5427. [PubMed: 24833873].
73. doi: 10.2471/BLT.08.065722. [PubMed: 20428355]. 44. Sayan M, Sargin F, Inan D, Sevgi DY, Celikbas AK, Yasar K, et al.
39. Locarnini S. Transmission of antiviral drug resistant hepatitis B virus: HIV-1 Transmitted Drug Resistance Mutations in Newly Diagnosed
implications for public health and patient management. J Gastroen- Antiretroviral-Naive Patients in Turkey. AIDS Res Hum Retroviruses.
terol Hepatol. 2010;25(4):649–51. doi: 10.1111/j.1440-1746.2010.06255.x. 2016;32(1):26–31. doi: 10.1089/AID.2015.0110. [PubMed: 26414663].
[PubMed: 20492319]. 45. Bagheri Amiri F, Mostafavi E, Mirzazadeh A. HIV, HBV and HCV Coinfec-
40. Torresi J. The virological and clinical significance of mutations in the tion Prevalence in Iran–A Systematic Review and Meta-Analysis. PLoS
overlapping envelope and polymerase genes of hepatitis B virus. J Clin One. 2016;11(3):151946. doi: 10.1371/journal.pone.0151946. [PubMed:
Virol. 2002;25(2):97–106. [PubMed: 12367644]. 27031352].
41. Sayan M, Senturk O, Akhan SC, Hulagu S, Cekmen MB. Monitoring
Hepat Mon. 2018; 18(1):e12472. 9